Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name LSP1
Systematic Name YPL004C
Strain S288c
Description Eisosome core component; eisosomes are large immobile patch structures at the cell cortex associated with endocytosis; phosphorylated on Thr233 upon Pkc1p hyperactivation in a Slt2p MAPK-dependent fashion; null mutants show activation of Pkc1p/Ypk1p stress resistance pathways; member of the BAR domain family
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>LSP1 YPL004C
TTACCATCCCTTTCAAGTTTTGCAATACACTTCATGAGCAAAACAGTATATGGAATACCA
GAAAACGTGGCTGTATCCATTTTACTTAGGTCAAATGTATCTACGTAATTTATTAGTTCA
GGCCAAGGGTTCTGTAACCGTAAATCATACTTCTTACTATCTGGGTGTGCTTGCAAAACA
AAATGTGTTTCTGAGAGTACCAGATATATATATCCATAAAATCCAGAGACGAAAGTGTTT
AGAACAGGCGGAAACTTTGTTCCTCTCTGCCGCCTAATCTCATTTAAATCGAGCATCGCA
GTTTGCTCACCAATACAAGTCAAGATCACCACCGAGAAGCGGGTCCAATCATACTGAGGT
TGCTGTAACGTCTTTCTAAGGTCATTTTCCTCATATTCTAGCTGTTTAGAAGCCAATGGC
TCAAGATCTTTTTTAAGCTCTGCTAAAAACAGAGAACCCGATTGAACTGCACACTCTACT
TTGAGCCAAGTAAGAGATGATATTCCGGCAAGCACCAGATTCTTAAAAACTTCCTGCAGC
AAAGGTGTAGCAGGTCCTACCACGCACACACGGGACCGGTTCAAACTATCTTGGCCCAAT
GCTCCCCATAGTCTCAGCTGTCTATCATATCTTTCCATATTTTCATCTACGGCTGTCTAG
TTGGCCTAAGAAAGAAAGAGAGGCGACTCATTTTTTTGACGTCAATCGTCTGACTTGTCC
TTCTATTTCATTGCTAGGCTAGAAAGCTTAGCTCTTACAACCCCGCTCGTTGCAGCCGAG
TGAAAAGGGGATTGCGAAAGGCGTTAGAGGGGATAAAAAGGGGCCCTTTAAAAAAAAGAC
GGAAAAACCGGGAAGATGCAACGGCTAAATCGCAATATATAAACAGGTGAGATAGAAAAG
AAAAAAATCAGTTAACCTCTTTCCTCAATTCCAATGCTTGACCGTAAATTCTCTTTATTT
GGTATACGAAAGATTAAACTTTCAAAGCTCCAACACAAGA
Chr coordinates Chr XVI from 551657-550632
w3c xhtml validator w3c css validator