Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name AEP3
Systematic Name YPL005W
Strain S288c
Description Protein that may facilitate use of unformylated tRNA-Met in mitochondrial translation initiation; localized to the matrix face of the mitochondrial inner membrane; stabilizes the bicistronic AAP1-ATP6 mRNA
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>AEP3 YPL005W
TCATCATCCTTTGAGATCCCAAAAGGACTTTATCCAGGCGTATAGTGATGGAGTTAGGAT
ATCAAGTTCTTTCCCCGAACTAGATATGTTTGCATACTCGCCGTTTTACATTTTTTTTGT
TCAATATCAAACTTTGGGACCATTGACGTTGAAGCTAATAGGGAGTGCCATTATCCTAAT
TTTTTTCATTTCATCTGTTTTCTTGCAGAATATACGCAGCTCATTCTTACTGGCTTTGGT
CGTTACCATGATTATCGTAGATATTGGTGCTTTGATGGCCCTACTAGGTATCTCACTCAA
CGCTGTCAGTTTAGTCAATTTAATTATTTGTGTCGGTTTGGGTGTCGAGTTTTGTGTTCA
TATTGTTAGATCATTTACAGTGGTCCCCAGTGAAACCAAGAAAGACGCAAACTCAAGAGT
TCTCTATTCCTTGAATACCATAGGTGAGTCCGTCATCAAAGGTATAACTCTAACCAAATT
CATTGGAGTTTGTGTACTTGCATTCGCCCAATCGAAAATATTTGATGTATTTTACTTTAG
AATGTGGTTTACACTAATCATTGTAGCAGCATTGCATGCTCTCCTATTTTTACCTGCTTT
ACTTTCATTGTTTGGTGGTGAAAGCTATAGGGACGATTCCATCGAAGCAGAAGATTAGCC
ATAGCAGATTATACTATATTTTACGTAGTGAAAAAATAGGTAAAAATTCGTTAATTATTC
TGATGCCACACCAGAAAATCTGTGGGAAAATTTTTCGAGTCAGAAATGATAACACTAACA
CAGGCTTCGTTGTTATCGTGCATTGAAGTTAGATACTTCTACTATATTTAATCTTTAATA
GTGTCATAAAAGTATTATTGGTTTCGGGCGAAAATCGTCATTTTCGCACACAGAACTTCA
AAAGAGGAAAGGCCAAAAGAACTAAAACCGATTACTTCGGGGTGATTTTGTTCTGGCATC
TTCTGGCACTCTTGGGCATCCTTAGCCATTTAGTATATTT
Chr coordinates Chr XVI from 548486-550306
w3c xhtml validator w3c css validator