Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RET3
Systematic Name YPL010W
Strain S288c
Description Zeta subunit of the coatomer complex (COPI), which coats Golgi-derived transport vesicles; involved in retrograde transport between Golgi and ER
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RET3 YPL010W
TCGTTTGTTATGGTAGTGTGGTGATGGCGGCTTAGAATGGAAGATTTATAGCCTGCAATA
TGTGGTAAAGCCGGTACATTTTGAGATTCTTTTTTGGAAGCTCTTTCAATCATGTTTATA
CGTTGTCTAGCAATGACTAATTTGATCCAATCATCTAATCCATTATTATTTATTAGATCT
TCTATCAACTCTGTTTTTCTATTCTTTGTTTCTAATTTCTGTTTCGCACCCTTGTTTTGC
AGTAATTGATTGAGATAGTCAGGTATTGCTGACAAAGGATCAGATTCTTTTTCCTCACTT
TGTAGTAATTCTACTGTGGGTAAGGCAGTTATTCGCGCGTCGGTCAATTGAGTACTATAA
ATACACCAGTCCTTGAACTTTTCCATTCCTCGTGAACTTGATAATTCGGAGTTTTCATCA
TAGACATCCAGAACGTTCGTAGGCTTAACAATACCTAGATTTTCCAGAGCCAGAGTTATA
TCTTGTAAAGCAATTGTATCGTCCTGATCACATCTTGCCTGAGCGATAGAACTGACCTCT
GATGCTAACAAACTCAAGAATTTTGCATAGAGATCGGTCATGACATCCACCAGACTGGGC
CTTGCCCTGTCAAATCCTTGTGCCTTCAATAATTGGAGAATAGATATGCGTAGTAGAGCA
AAATAGAAGTCATTATTTGTAGTCATAGCAGAGGAACTCTATTGACCCAAAGATATCGCT
GTTTTCCGCTAGTAGGTGATTTGGAATTGCTCAGGAAGCTACTTCAAGTGTTATATTAGC
ATACCTTCATCATGCAATATGAAATTACTGAAAAAAAAAACTAAAGCATCGCGAGCTTAC
CCGTTTCGCCACTTCTGTCAAGTGAAAAAACACGTTTGCATTGTTTAGGCTACAAGGTGT
GGAATATCGAAGTTATTGCTAGACAGAAGTTCTTTAGGCATTTAGGTTTTGTTTGTGAGC
TGGCTTGCTAATTTTGAGTACTGTGCATCATTGTTCCAGG
Chr coordinates Chr XVI from 535018-535587
w3c xhtml validator w3c css validator