Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CIP1
Systematic Name YPL014W
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm and to the nucleus
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CIP1 YPL014W
ATACTCTCTTCAAAACGTCTTTGTCTTGAAACAATTTCAAAAGATAGTGAAACTTAGAAG
GTCTGAAATTTCCGGGATACAACTCTTTAGCCAAAGTGTAAAATGGCAAAGGATCCGATT
GGAAAAAATCGACATCGAACACTGCTTCAGGGTACGGCAACTTCAACCTGGCCAAGTTAT
GGTACAGGCCAGTTCCCGGAGATCGGAAGTCTGGTATCCCACAAGAAGTGGATATCCCGG
CACCCACCATAAAGATTACTTTAGCGTTGGGGTTGCTTTTCATATGAGCAGCGATCTTCC
TAACCGACATCTCTGTAGAGGCGGTAGAAACAGACATCGAAACACGGAGAGATCGCGGTA
CGTCTGGTTGGTAGCTCAGTGACGGGCACAGATAGCGACATTTACTGATACAGAGACAGT
TACGAAAGATGGAAACACATGCAGAGAATGTGGTCTATTCCTTATTCTTAAGATCGGCGA
AGCTAACAGAGTTAATGCTGGGCCATAGCTGGACGGCAGAAAGCACGCAGGCAGGGGGCC
TCTGCGTAGGGCGGGAGACGCCTCCGTAAGGAAAACGGCGCGGGAAGGGCGGCTTCTTAC
TACATTTTTTTGCCACTCCGGAACTCGCGCAGGGGGAAGACATATGCCCACTTTGGGAAA
TAGAAATGGTCATTTTAAGCTCAAGTGAAGCGAAAAAAGGAGGTATACTCCTTTACGCGT
CACCCAATCTGGATAGGCACGTCAAACTCATTAGGTCTCATCAAGAACTAGTGTAGAAAT
GACGCTTGAACTCCGAACTTTAAACAAAGTTCTGTTTTTGTTTCTGTTTCTGTTTCCTGT
TGCTGTCTCTGTTTCTATTTTTTTCGTATAGCTCTATTTCCCTTGTAGATAAACATATAT
AAGAATGCTATTATAGAAGCGTGTATTTTCCTCCCCCTAGCTTCAACCTGTAATTCCCTT
CTTAGTAAAGCGAACTAGAACCAGTTTAATAGGATATAGA
Chr coordinates Chr XVI from 527547-528692
w3c xhtml validator w3c css validator