Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CIP1
Systematic Name YPL014W
Strain S288c
Description Cyclin-dependent kinase inhibitor; activated by environmental stress; interacts with and inhibits the Cdc28p/Cln2p, G1/S phase cyclin-dependent kinase complex but not S-phase, or M-phase complexes; overexpression blocks cells in G1 phase and stabilizes the Cdc28p inhibitor Sic1p, while disruption accelerates the G1/S phase transition; phosphorylated during S phase in a Cdc28p-dependent manner; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm and to the nucleus
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CIP1 YPL014W
ATACTCTCTTCAAAACGTCTTTGTCTTGAAACAATTTCAAAAGATAGTGAAACTTAGAAG
GTCTGAAATTTCCGGGATACAACTCTTTAGCCAAAGTGTAAAATGGCAAAGGATCCGATT
GGAAAAAATCGACATCGAACACTGCTTCAGGGTACGGCAACTTCAACCTGGCCAAGTTAT
GGTACAGGCCAGTTCCCGGAGATCGGAAGTCTGGTATCCCACAAGAAGTGGATATCCCGG
CACCCACCATAAAGATTACTTTAGCGTTGGGGTTGCTTTTCATATGAGCAGCGATCTTCC
TAACCGACATCTCTGTAGAGGCGGTAGAAACAGACATCGAAACACGGAGAGATCGCGGTA
CGTCTGGTTGGTAGCTCAGTGACGGGCACAGATAGCGACATTTACTGATACAGAGACAGT
TACGAAAGATGGAAACACATGCAGAGAATGTGGTCTATTCCTTATTCTTAAGATCGGCGA
AGCTAACAGAGTTAATGCTGGGCCATAGCTGGACGGCAGAAAGCACGCAGGCAGGGGGCC
TCTGCGTAGGGCGGGAGACGCCTCCGTAAGGAAAACGGCGCGGGAAGGGCGGCTTCTTAC
TACATTTTTTTGCCACTCCGGAACTCGCGCAGGGGGAAGACATATGCCCACTTTGGGAAA
TAGAAATGGTCATTTTAAGCTCAAGTGAAGCGAAAAAAGGAGGTATACTCCTTTACGCGT
CACCCAATCTGGATAGGCACGTCAAACTCATTAGGTCTCATCAAGAACTAGTGTAGAAAT
GACGCTTGAACTCCGAACTTTAAACAAAGTTCTGTTTTTGTTTCTGTTTCTGTTTCCTGT
TGCTGTCTCTGTTTCTATTTTTTTCGTATAGCTCTATTTCCCTTGTAGATAAACATATAT
AAGAATGCTATTATAGAAGCGTGTATTTTCCTCCCCCTAGCTTCAACCTGTAATTCCCTT
CTTAGTAAAGCGAACTAGAACCAGTTTAATAGGATATAGA
Chr coordinates Chr XVI from 527547-528692
w3c xhtml validator w3c css validator