Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SWI1
Systematic Name YPL016W
Alias ADR6, GAM3, LPA1, [SWI(+)], [SWI+]
Strain S288c
Description Subunit of the SWI/SNF chromatin remodeling complex; regulates transcription by remodeling chromatin; required for transcription of many genes, including ADH1, ADH2, GAL1, HO, INO1 and SUC2; self-assembles to form [SWI+] prion and to alter expression pattern; human homolog ARID1A is a candidate tumor suppressor gene in breast cancer
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SWI1 YPL016W
AAAGATAAGACTCATATAACAAGGTCTTGGACGGGACTGCCCCGTCTACAAGGTAGGCGC
CCCCCAGCGAGGCACGCTGGTCAACACATGCTGTGAGCAGGCCTGCTTGCGAAGCCTGCA
TCGCTGCAGTAAAGCCACCAGGCCCGCAACCAATTACCAGGACATCGTAAACTGCCGCAA
AATCCTCCATCGTGCTTAATATTTCGTCTTCACCTCCCATTACCAAAAATGCTCACCGTT
AATTATATCATACTTCTCTTCTCCTCTCGTAAAATCGTGCGCATGTTAAATAGCCGCCGA
AACAGCAGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGC
CTCGCCGGAGGAAAATGCCACCGCACTCAAGTTCGCACAGAAACTACCGCATAAATTTAT
TCTAACCCGGAACTGACGTTTATCGTGATATGAACTTTGGGTATCTCCGATTACGAAACG
ACGCCACCCCTCCTTCCCCAAAGCACCGAGAAAAGATTTTTTTTAAAACTGAACGCTGAT
TGACTTTACGTATTATTACCACTATGCATTATTGTTGTTTCTGTTGTGGTTGTTGCCAGT
TGTAATCATATTCACATTGCGTTTTAGTCATAACCACCTTCCGGTATTCATCATTCGTAT
TGAATAACAATATTTATACCGCAAAACACTATACGGCAAGGCAACTGATTACACTTTGTT
TACCTTATTTTTTTATTATTTATTTTTCTAGAAAGTATTGTTGTGTGGCTCTATCCTTAT
TACACCATCTCTGCTTTGGCATTTCGCGTTGTTTCCTCTCACGGATTGCAGATTATTGTT
CACCAGGTAATAATCACTGACTGGCGGCTATTTTCCTATTACACTCATTATTCTTAAAAT
TTTCTTTTTCTATCTCTATTTTCTTTCTTTTCGTGTCTTATAATAATAATAATAATAATA
ATAATAAAAATAGTAATAATAAAAATAGTAATAAATAAAG
Chr coordinates Chr XVI from 521014-524958
w3c xhtml validator w3c css validator