Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SWI1
Systematic Name YPL016W
Alias ADR6, GAM3, LPA1, [SWI(+)], [SWI+]
Strain S288c
Description Subunit of the SWI/SNF chromatin remodeling complex, which regulates transcription by remodeling chromosomes; required for transcription of many genes, including ADH1, ADH2, GAL1, HO, INO1 and SUC2; can form the prion [SWI+]
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SWI1 YPL016W
AAAGATAAGACTCATATAACAAGGTCTTGGACGGGACTGCCCCGTCTACAAGGTAGGCGC
CCCCCAGCGAGGCACGCTGGTCAACACATGCTGTGAGCAGGCCTGCTTGCGAAGCCTGCA
TCGCTGCAGTAAAGCCACCAGGCCCGCAACCAATTACCAGGACATCGTAAACTGCCGCAA
AATCCTCCATCGTGCTTAATATTTCGTCTTCACCTCCCATTACCAAAAATGCTCACCGTT
AATTATATCATACTTCTCTTCTCCTCTCGTAAAATCGTGCGCATGTTAAATAGCCGCCGA
AACAGCAGATGCATGCCTGCAGGTCTGGGTGTACCCCCTGCCTGAGTGTTCCACCCAGGC
CTCGCCGGAGGAAAATGCCACCGCACTCAAGTTCGCACAGAAACTACCGCATAAATTTAT
TCTAACCCGGAACTGACGTTTATCGTGATATGAACTTTGGGTATCTCCGATTACGAAACG
ACGCCACCCCTCCTTCCCCAAAGCACCGAGAAAAGATTTTTTTTAAAACTGAACGCTGAT
TGACTTTACGTATTATTACCACTATGCATTATTGTTGTTTCTGTTGTGGTTGTTGCCAGT
TGTAATCATATTCACATTGCGTTTTAGTCATAACCACCTTCCGGTATTCATCATTCGTAT
TGAATAACAATATTTATACCGCAAAACACTATACGGCAAGGCAACTGATTACACTTTGTT
TACCTTATTTTTTTATTATTTATTTTTCTAGAAAGTATTGTTGTGTGGCTCTATCCTTAT
TACACCATCTCTGCTTTGGCATTTCGCGTTGTTTCCTCTCACGGATTGCAGATTATTGTT
CACCAGGTAATAATCACTGACTGGCGGCTATTTTCCTATTACACTCATTATTCTTAAAAT
TTTCTTTTTCTATCTCTATTTTCTTTCTTTTCGTGTCTTATAATAATAATAATAATAATA
ATAATAAAAATAGTAATAATAAAAATAGTAATAAATAAAG
Chr coordinates Chr XVI from 521014-524958
w3c xhtml validator w3c css validator