Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CTF19
Systematic Name YPL018W
Alias MCM18
Strain S288c
Description Outer kinetochore protein, required for accurate mitotic chromosome segregation; component of the kinetochore sub-complex COMA (Ctf19p, Okp1p, Mcm21p, Ame1p) that functions as a platform for kinetochore assembly
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CTF19 YPL018W
CCAGTAAAATTTAACCTGTCAAAGTTATCCAATCTTTGAGCCTCATCTAGACATTCTTCT
AAGGTGTTTTTGAACTGCTCAGAATTTATTTTTTGGATTTTTTCAGCTGATTTAGTGTTT
TCCTCTAAATCATCTAATTTTCGCAAGACAGCATTATATTTGGAAATTTGAAATGTGTAA
ACCTTTTCTAGTTCTTTATCCAAGGCCTCCACAAAATCAGATTCATTCCTTTCGGACCAA
CTATCCACGGAACTACGGCCATCATGTATGACGCTTTCCTTTAGTAATTTCTTCAACCTT
TCATAGTCGATATATGAATCCTTCCAGGGAGGATATACGTCGTTAGCCAGTTTAATACCA
AATAGCATTTTCAAACTCTGAAAACCAAGGACAAATTCTGCTGTTCGCTCTAATAGCCAA
ATGACCTATAGTGATAATAAAAAAAGCGCTAAGGAGGTACTACTTGGATTAGATCACTCT
TATGCGTATTATTACCCGCCAATGGGCCCTCTCGATATTGAGAAGATGAAGTAAGTTCGA
GAAAAGATGTCTGATGTAAGCCGCTCTCTGGCCTCTATTTAAAAGTTCTTCCTGGATGAA
ACCCACTCGAAAGTTGGGTGTGTGCGTGTGTGTATGTTTCCACGTTTCTGCCTTGTGCTT
TCAAAATCGCATGCACGTGCTTGCGACTGCACTGTGTTGTATTAAGCCACGTGGGCCCTC
GCACATTGAAAAAAAGAAAAGCTGTACAGGGAAAAATGTGCCAAGAAGTCCAAATACCAA
TAGCTGTGCAAGTTACTCATTAACATCCAAACCGTGAAGGTCACGGCATATATACTCTGG
CGTTCTACTATGTGGCCGGTAATGTAACCGGTAATGGTGACTATCTAATAGTTGGAGTCC
GCCGAAAAATCAGAAACGCGTAATTTAGACTTATATAAACAGCTATATACCTTGGAGCTA
GTGTGATCTTGTTGATACTAGGTCGGCAAAGAACGCAAAT
Chr coordinates Chr XVI from 517651-518760
w3c xhtml validator w3c css validator