Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ERG10
Systematic Name YPL028W
Alias LPB3, TSM0115
Strain S288c
Description Acetyl-CoA C-acetyltransferase (acetoacetyl-CoA thiolase), cytosolic enzyme that transfers an acetyl group from one acetyl-CoA molecule to another, forming acetoacetyl-CoA; involved in the first step in mevalonate biosynthesis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ERG10 YPL028W
ATTGAAGCACCTGTGGAGTATTTAAAAACTGCGGTTACATGGCCTACAGATGAAATATGT
GCTCAACTAATGACACAATTCCCACCAGGAACGCCGACCAGTGTCCTGCTGCAGACTATT
TCAGATGAGCTAGAGAAAAGTTCTGACAACCTGTTCACGTTATCTGATTTAAAGAGCAAA
CTGAAAGTTATTGGCTTATTCGAGCACATGGAAGATATCCCATTTTTCGACAAGCTGAAA
CTAAGCAATGCGCCCGTGAAGGACATGCCTATGGTCACAAAGGCGTTCACCAAATTTTGC
GAAACAATAGCAAAAAGGCATACAAGAGGCCTACTGTCATACCGATTACCTTTTAACCTA
CTGGACTACAATTGCATACCGAATGAGAGTTATTCATTAGAGGTTTATGAGTCATTGTAC
AACATCATTACTCTATACTTCTGGCTCAGCAACAGGTACCCAAACTACTTCATTGACATG
GAATCTGCTAAAGATTTGAAGTATTTCTGTGAGATGATTATTTTCGAGAAACTTGATCGA
TTAAAGAAGAATCCTTACGCACATAAGCCCTTTGGTTCTACAAGAGGTCACCTCTCATCT
TCGAGAAGAAGATTGCGTACATAATCTACGATATATCCTGTAAATAGAAACAGCTACACT
GCTTGAAAGCCTTAACATGATACATTTCTGGTATGATGCCATTGTTGTGCCCTGCCGGGT
TTATCGTTTCCTAACAGGCACGTCACTTATAACGAGGTGCCTGTCGTTTACCGCCCAAGC
CGGTTTTTTCGCTGGAGAGTACGGTACTACTAGCCCACCACACGTTCGTGGCCAGGTTGA
TAGGCCACCGTTGAGCAAAGGGCAGTAAAATATATAAAAGAGGAACAAGCGCTTCCATTA
AGAGCACTGCTAAGCCTACTCGTTTTCTAGTTCTCTGAAAAAAGGTAGCCTAAAACAAGC
GCCATATCATATATATTTATACAGATTAGACGTACTCAAA
Chr coordinates Chr XVI from 498096-499292
w3c xhtml validator w3c css validator