Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PHO85
Systematic Name YPL031C
Alias LDB15, phoU
Strain S288c
Description Cyclin-dependent kinase, with ten cyclin partners; involved in regulating the cellular response to nutrient levels and environmental conditions and progression through the cell cycle
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PHO85 YPL031C
GTCTTTGCTATTTAGGATTAAACATGTTTGGTTTATGATAGCATCTTTGTAAAAATTCCT
AGGAATGATCCTTCTTACAAATTCATGAACGGGTGACAATTTTAAACTCTCAGATGTTTC
ACACGACCTTATGTTTAAATCTTCAATATTTATCTTCTTGACATCTTCTTCACCGCTTTC
ATTACCATTATCGATCTCAAACTTTTTTAATACGGACTCGTCAAATTTTGGCTCAGACCC
AGCTTCTGCAGCATGATTGATCTCTTTCAAAATATCCGCTCTTAATATGACAGTAGAGTT
AATATTTGGTTCTCTAATAACGTTCATCATTGCTTGCTCGAAGTGGGACTTTGCGAATGT
TACTTTCCCATCCGTTTGGTAAAGGCTTAACCATTGAGGTCCTAGAATACTTTTATCATT
CACAATAAACTTGAAGCGATCTTTGTGTTGATTTTGATTGTTTTTAGAAATATGTGCACT
ACCGTCGCCAGTCATTGTTGAGAGAAAGGAGAAGTATCACAAGATAGCAATATAATCGGA
CCAAATGCGTTGTCTATCTTGCGTAATGGAAATCGCATTTTCTAAATGATATGGTTTATT
TCAAAGAATAATGTCATCGGGTTTTCCAAAATGCAAAAAATGAAATTTTTAACAATGCAG
AGCAAAAAAGTGAAGAATAAGTGCACTACTAAAACCAAAAAAACAGGAAGAAGGTGCAAA
AACGCAAAAAGTAGTTACCATAGTCCGTCCAGACACGTTAAATGAATTGATAGACACGGA
GGGATAGACAGGCCGGATGCGCTACTTCTATCTATCCTAGACCCTTTGCTTGTCCTCTGT
GTGCAGTTCATTTTCCGTACAAATCACCATACACGTAGACTCGTAAGCCCGTAGCTTTCT
AATTGAAAGATAACAAAGGGAATCCAGTTTTACCATATAGCGTATAATTGCAGATAAGGG
ATATATAGCGCGGCAAACTGGGCAAACTTGAGCAATACCA
Chr coordinates Chr XVI from 492918-492018,493037-493021
w3c xhtml validator w3c css validator