Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SRL4
Systematic Name YPL033C
Strain S288c
Description Protein of unknown function; involved in regulation of dNTP production; null mutant suppresses the lethality of lcd1 and rad53 mutations; expression is induced by Kar4p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SRL4 YPL033C
GAAGTTACAAATAATAACAACAAAGTTAATAACAGTAGTAGCAACCCTGATATTTCCACC
AACTCGGTAGTTCATAACGCAATGCAATTTACAAATACAAACAACAATACAAGTAGCACT
GTGGATATAAACGATCCCAAAAATATTGCACCCCCTCCTACAACCTCTGTTTCAGCCCCA
AGCACTCCAACCTTGTCCTCATCAAGTCAAATGGCGAATATGGCTTCGCCTAGTACCGAT
AATGGTGACAATGAGGAGAAAAATGGTGGTAAGAAGAAGAGATTTGGCCTATTCAAAAAA
AAAAATAAATCAAAGAAATAATATCCTTCGACAGCTTAATGAACACGCATGTAAATGTTT
TGTAAACAGTTTGTTTTTTCGTTTTTGTATCTGTTAATTTTCTATTATTTATTTTTTTAG
TTTTTTTTTGCGGTAGAATTGGGTTATCACTGAATCTATTTTATTTTTTGGGTTGGTTTC
TCCCTGTTTTCAGTTTGTTTGAATTGGTGTTTAACAAAATCTGGAATTATTCACTATAAT
TATTTCCTCTTTTTAGTTTGACCAAATAAACTCAACTATCTTGTGTTATTTCTTTGTATT
ATAGCTTTACACATATTTAACTATCCATACCTTTTACTTTTTGTATATACTGTTAATTTC
ATAAAACACGTTTTAGTACCAGAAAATCGTGTCATAGCACCGTTTTAGCAGTGATTTTTA
AAATTGTCCAAGGTGCCAATAAATACTGGTGGGAACAACATTTTAATTAGAATAGCTAAA
ACCTTCTAAGAAAACTATCCCAGCGTAGAAAGAAAGAAATCTCTATCAGCCGCGCAAGTG
CAGTATCTCTTATTTTTGCACGGCCCCGTCGCTATATTGTCACACGCATTTGAATTAGTG
ACTCAATAATAATACAGATTTGTGACGTATAAAGAAACCACAGAAAAACTGCGTATGTCC
GAAGCACAGGTCCACTAGTAATAGAGCCCAAAAATCTGAC
Chr coordinates Chr XVI from 488207-487362
w3c xhtml validator w3c css validator