Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPL062W
Systematic Name YPL062W
Strain S288c
Description Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; YPL062W is not an essential gene; homozygous diploid mutant shows a decrease in glycogen accumulation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPL062W	6325195 upstream sequence, from -1000 to -1, size 1000
ATTAGTAAGATTGATTCCATTTTTGGAGTACCTTGCCACTCAACAAACCAAGGATGTTAG
ACCAATCTTGAACAGCTTTGAAGACAAGAAGAACCTAGCAGAAGAATTTGATCATCGTGT
GAAAAAATTGAAGGATAAATTTTACGGAGATCATAAATCTGGTGGCAACTGGGCAATGAC
GGCACTAGGTCTCGGAAATTCCCTGGGCGGCAGCACCAAGTTCCCGCTCGATTTGATTCA
TGAAGAAGGACAAAAGAACTATTTAATGTTCATGAAGATGATTGAGGAAGAAAAGGAAAA
AATTAGAATACAGCAGGAGCAAATGGGCGGGCAAACATTTACGCTGAAAGACTATGTTGA
AGGTAACTTGCCTTCGCCAGAAGAACAAATGAAAATACAATTGGAGAAGCAGAAGGAGGT
AGACGCCTTATTTGAAGAGGAAAAGAAAAAGAAGAAGATTGCTGAATCCAAATAATTTTC
ATGTAAACCCTCTTCTCATGTATCTACGTATCTATGTGTGTATGTAAATGTACCTGTACA
CTCCCCACACCCTCATTTTGTTACTGTCATGTGAATAAAACTTATGTATATTGCTAACTT
ACTACCACTGCACCTCCTAACATCACCATACTACGTACAAACACGCCTATTTATTTTTTC
TATGTTAAATTTTAACGATGTAGACACACCTAATGATCTGATGCGCTTTGCATATCTCAT
ATTCCTTCACTAGCATAAAAATCCAAAAAAAAAGAATATTTAGGCCGAATGGAATTATTC
GTAACGTCATACGAAAAAAGTTTCAATTCGTACAATGCCTGGCATGTTCATTCGAATATA
AGGCCGCCGCCTTCCAGTCAGGGTAGCCAAAAGTATAATCCCGGGTGGAAACTAAACTAA
AAACCGTACTCACAACTTTCCGCGGACGCTAACAGACAAATAGACACACTATCAGGTCAG
GAACTGCCGTCACATACGACACTGCCCCTCACGTAAGGGC
Chr coordinates
w3c xhtml validator w3c css validator