Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RGL1
Systematic Name YPL066W
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to the bud neck and cytoplasm; null mutant is viable and exhibits growth defect on a non-fermentable (respiratory) carbon source
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RGL1 YPL066W
AAAAAAAAAAAAACTTTATCAGGCAAGTGGCTCGAAACCGTGTGAAAGGATATCATCAAC
GGTCGTTTTTACCTGTTCCGCGGAATAGCGTTCCCGTGGGAAGAAAAGCAGCACGTGAGC
GTGGAAAATCCGGGCAACACTTTGTAGTTCCGGGTAGTTGACAAACCAGGCCACGTGACC
CGAGCTTAGAAGTGGACGCAGTAGCGGCTGTGCCTGCAAAAATGCATTCATGCGAGCGCG
GGCCGCTTCGCGCACGGCCTTATCTGGGGAATGTACTGGCAGGGCAACCTTGGACCAGAG
AACAAGGTGTACAACACCAGGCTCGAAGTTATACGGGAAATCGTTGGCACGCACAGCATA
TAGAGTAGAAGAACTAAAAGCCTTCGCGGCAGCATTTTCGAGCTGCGGTTCGTCTAGCGA
CCAGCCTAGTTTTTGCAAAACGTACTGGTTCATGTCCAGGCCAGCAGTCCTTTTCTTATG
CTCGTGGTATTTGTCAGTCATCTGGCGACTTCGTTTCAAACGGGCAAGCTCCCCCGATTC
AATTATCTCTTTGATTTGTTCCCACTTCCACCCTTGGGCCTCCTCCTGGTGATCGTTGAC
GATATCTTGTTGCATTGTAAACCTAAGCTGTTATAAGTAAATCAAGTGCAATACAAATAT
ATACAGCATGCTGGCGTCCTTAGCCTCACGCCTACTAAACAAGAGCATCTTACTCTCACC
ATCCATTTATATACATATATAAGTACGTAAAAATAGATGTGTATAAGTCGTTCTATCTAT
AACGCGCCCCGAAGTTGTTTAGTATAACAAAAACGGAAAAAAAAAGAAGGAAAATGGAGA
TTGCCAAAAGCGCGCTAGTTTGACAGAAAGAGTGAAATATTAGTTCAATATTTCAGCTGT
CACGGTCATCACTGCTCCGACACTTTTTTGTGGGATGCTTTCTGTTCACCTTGGTTTTCT
ATGGGTATATAACAGCTGATAAAGAATCGAAGAAGTGAAA
Chr coordinates Chr XVI from 426233-427672
w3c xhtml validator w3c css validator