Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YTA6
Systematic Name YPL074W
Strain S288c
Description Putative ATPase of the CDC48/PAS1/SEC18 (AAA) family, localized to the cortex of mother cells but not to daughter cells
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YTA6 YPL074W
CCAGTACCAATTTCTAATATTCATAATTCTACTGAGGCTGCAAATTCAAGTGGTACAGTG
ACAAAGACAGCTCCATCATTTCCGCAGAGTTCTTCTAAGTTTGAAATTATAAATAAAAAG
GATACGAAGGCGGGGCCAAACGAGGCAATCAAATACAAGCTGTCCAGAGAAAATAAAACA
ATATGGGACCTATATGCGGAGTGGTATATTGGTCTGAACGGTAAATCTTCAATAAAAAAA
TTGATTGAAAATTATGGCTGGCGAAGGTGGAAGGTTAGCGAAGATTCACATTTTTTTCCT
ACTAGAAGAATTATTATGGATTATATTGAAACGGAATGTGATCGTGGCATAAAACTCGGC
AGGTTTACTAATCCTCAACAACCGAGGGAGGATATACGGAAGATTTTAGTAGGGGACCTA
GAAAAGTTCAGGATAAATAACGGTCTGACTCTGAATTCTCTATCATTGTACTTTAGAAAT
TTAACGAAAAATAACAAGGAAATTTGTATTTTTGAAAACTTTAAAAATTGGAACGTTAGA
TCAATGACAGAAGAAGAGAAATTAAAGTATTGCAAAAGGCGACATAATACACCATCTTAA
GTTTATTGAGGTTGTCCGCGACAATAGTTCCTTCAACAAAATAACGAAGCGACGATAACG
AGAAATGTCATTAGGTTATTACTACCTTTATAGAAAATATATATACTTATTTAATATTTA
TATAGATTTATGTGTGTACATACCTATGCGGATGTATGCCTATGTGGGAATTCCTAAATG
TCTTTCCATCAACGACTAAATATATATTCTCATGACTGACTATATGGGTTACGAAAACTT
AATTTTTTTGTCAAAGACCCTGGCGAATTGAGAAAACCCGCTGGATAGATGGGCTATCCG
AAATTTTGAAAGATGGAAAAAACATTAATCTCATTAGCAAAAGAGGTAAGACCCTGGGTG
AAGAAAAGTCCGAGGAGGGAACACAAAAAAGTCTAGGATA
Chr coordinates Chr XVI from 415763-418027
w3c xhtml validator w3c css validator