Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPS9A
Systematic Name YPL081W
Alias rp21, S13, S4, S9A, uS4, YS11
Strain S288c
Description Protein component of the small (40S) ribosomal subunit; nearly identical to Rps9Bp and has similarity to E. coli S4 and rat S9 ribosomal proteins
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPS9A YPL081W
AACGAAAGAATGTCTTCGGGGTGCTGTTTGGCCAAGTCTCCCATTTGATCGGCAGCCATG
TTCCGGACTACTTGGGTGGAACCGGTCTCTATTAATATTACCTGCCGGTCCAGCCTCGAA
ACTCGTGACGTCATTTGAGGTGCTGTGTGTGTTGTGATACTTTTGTTCGTTAATATTGGA
ATACGATCGCTACTTATATTTTATGTTCTGAAGGACTCTAAAAGCAAATCAAAATAACCG
CCGAGCTGTGTGTTCAGAGCTATAATAGCAGAATGGTGGTTTTTTTCTGAGCGCAATAGA
AAATGGCGCGCAAACCGCCAAGGGAACGGAATTGGTGGAAATCATAAGCTTTTATATCAA
GTGCAGCGGCCGGCGAGTGGGACGTGCTTTTTTTACTTTTGGGTTTTTGCGATGAGGCGG
TAGACGCGTTGTCTTTGCGCCTGGGGCCCGCCGTCCAACGTGCGGGTACCGTACCCTGCA
GTGTTGCAATCGTGTACTTGCCTTATAGTGTCAGCTATTGATCAAGGCCACATGCAAAAT
AGGGAAGGGGGGCATTGGCACAAAAGAGTGGTTAGACGCTCACAGGGGTGACTACGGTTA
CAAGTCTAAATATTTTAAGCCCATCATTACCGGCAATGCCCTCTGTACAGGAGTTATAAG
AAAGATTATTCAATTTCGCGCTTGCATTATGAAAGAGGTTGCATTCTTCAATATCAGGTG
AAATGTGTCTTGCCTAGACAATCTAAAAAAGGCTGCACACCCATGCATCATTCTAAAAAA
ATTATTTTTTTTCTTTTCATTTACTTTTCGTTTTTTTTTTTTTTTTTTTCAGTTCGATTT
CTTGGTCGGACGCGATGGCAAATTTTTCATCGAGAGATTATCGTTATAAAGGCCTGTTGA
TTTTCAAAGAGATAGAAATCTTCTCTTTTAAGTATTCTTTTTTTAATTAATAAAAACACA
AGAAAACTAATACAGCAACAGAAATACAAAAGTATACAAC
Chr coordinates Chr XVI from 404950-404956,405458-406044
w3c xhtml validator w3c css validator