Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YDC1
Systematic Name YPL087W
Strain S288c
Description Alkaline dihydroceramidase, involved in sphingolipid metabolism; preferentially hydrolyzes dihydroceramide to a free fatty acid and dihydrosphingosine; has a minor reverse activity; YDC1 has a paralog, YPC1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YDC1 YPL087W
ATGATGTTGTTGAAGCGGGCCACGTTAGATACATTGGGGCTTCGAGTATGTTGGCAACTG
AATTTGCAGAACTGCAGTTCACAGCCGATAAATATGGCTGGTTTCAGTTCATTTCTTCGC
AGTCTTACTACAATTTGCTCTATCGTGAAGATGAACGCGAATTGATTCCTTTTGCCAAAA
GACACAATATTGGTTTACTTCCATGGTCTCCTAACGCACGAGGCATGTTGACTCGTCCTC
TGAACCAAAGCACGGACAGGATTAAGAGTGATCCAACTTTCAAGTCGTTACATTTGGATA
ATCTCGAAGAAGAACAAAAGGAAATTATAAATCGTGTGGAAAAGGTGTCGAAGGACAAAA
AAGTCTCGATGGCTATGCTCTCCATTGCATGGGTTTTGCATAAAGGATGTCACCCTATTG
TGGGATTGAACACTACAGCAAGAGTAGACGAAGCGATTGCCGCACTACAAGTAACTCTAA
CAGAAGAAGAGATAAAGTACCTCGAGGAGCCCTACAAACCCCAGAGGCAAAGATGTTAAG
TTAGATTTTCATGGGCCCACTGATATATAGAAGGCTAAATAACGAGAATCATATATACTG
TAACATGACACCTGCTGATTTTTACTGATCGTAGCCATTCGGCTCATATTACTTCATGTC
CCTTTTTTAAATCCCTCGTTCCCGGAGAGTGGCATAGCATGTCCGATAGCGTACGCCAAC
CTACAGAATCAGGGGATCAGATTTCCTGAAAGCAACTTATCCATCAGTTTCTTTTTATAA
TGCCATAATGACAGGTGTGCCTTTCTTATTTTACTTCGCTTGCTTTCTTTCTATTGCATG
CTTCAATCTTTGAATATTTGCTAATAGTGAAAAAAAAAAAGGAAATAACTATCTGGTTTA
TCTGCATTGTTCTTCGTTTTTCAATTCAAGAATTTAAGCAAAAGGATATATCATAGAACC
TAGTGAATTTTTAAGAAAGTAAGATAAAGAAAAAAATCAA
Chr coordinates Chr XVI from 383455-384408
w3c xhtml validator w3c css validator