Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SSU1
Systematic Name YPL092W
Alias LPG16
Strain S288c
Description Plasma membrane sulfite pump involved in sulfite metabolism; required for efficient sulfite efflux; major facilitator superfamily protein
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SSU1 YPL092W
GCCAAGATGGAAAGAAGAGAAAGAAATAGACATGCCAAGCAAGGTGAATCTGATAGACAC
AATGCTGTTTCCTTATCAAAGCATTTATTCAGTGGTAAGCGTGGTGTCGGTAAGACAGAT
TTCCGTTGATTTCTCTACTTCTTATTCTTTCTTTTGCATGTACTTTAAAAAAAATATGAA
TATAAAATGTGGATGTACGTACACGACATTCTAATCTTTTTGGGCTGGTAGGATTACCAT
TTACATTTGATTATCTCTCTCACTATTAGTGGTTTCTTTTTCTTTCTTTCTCACTTTTTC
TGTATCTTTTTTTTAAAAAAATTTTATTTAATCTGTATAATAATAATAAACCGATTTAAA
TTATCCAACAAGCCGACCCCTCCATGTTCTACTATTTTTTTGTATGTCACTGGATGTATA
CAAATAATTAAGCATGTGGAAAAAGAAGGGGTGGGATAGCGTCAAGATGACACTTCTACT
TTTTTGTGACACATCATCATGCAACCTATCGAGTCTCCCACGAGGTTGACAAATAAGAAA
TTGTTATCGTTTTTGCAGTGTATCGTATAAGGCAACAATAGCGATGTCTCCCATCAATTG
ACTGATAAATTCCTGCAAACTATCATTTTTTTTTTTTCATCCTTGTGCCGCGTCTGTAGC
CGAAAATCTGAGAGTGCATGAATCTTAAAAAACAGAAGACTCATCGCCGTCTTTGGCACA
TTGGGGTTGTCTTTGACTTCTTTTGCTTATTTTTGCTCACTTTGCTTATTTTACCTATTT
AACTAGAGGTTCTAAAAGAATAGCCAACCAGCGTGTAGTTCTTATTTCTAATCCTTGTCT
TGTTAAGTTGAAACTTGTGATATTGGCTGAACAAATTCTCCGCATTTAGACAACACACAA
ATTACAGCTTTCCCCTAGTAACGATTGTTGATTGAGCTCAGACAATACGCGCAATTTAAA
AACGTTTTATAGTGTAAGAGAAGACAAGTACAAGAAAAAA
Chr coordinates Chr XVI from 373793-375169
w3c xhtml validator w3c css validator