Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name EEB1
Systematic Name YPL095C
Strain S288c
Description Acyl-coenzymeA:ethanol O-acyltransferase; responsible for the major part of medium-chain fatty acid ethyl ester biosynthesis during fermentation; possesses short-chain esterase activity; may be involved in lipid metabolism and detoxification; EEB1 has a paralog, EHT1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>EEB1 YPL095C
ATACCTTCTAACAAGATCGAAGACCAGCTTAAGTCACGTGAAATCTTTATTCAACTTATA
AAGGCACAAATGGTGATCCCAGTGAAAAAATTGCATAGTCAAGAATGCAAAGAGCATGGA
TTGAAGCCAAGCAAGGACTTTCCGCACTTGATTGTTTCGAATAAAGCACAATTGGAAGCC
GATGAATACTTTGTTTGGAACTATAACCCTAGAACCTACATGGATTACTTGATCGTCATT
GGTGTCGTGTCCATCATATTGGCGCTCGTATGCTACCCATTGTGGCCGCGCTCCATGAGA
CGCGGCTCCTATTATGTGTCTCTGGGTGCCTTCGGCATCTTAGCAGGCTTCTTTGCTGTC
GCTATCCTGAGATTGATATTATATGTTTTGTCATTAATTGTCTACAAAGATGTTGGTGGG
TTCTGGATCTTTCCCAACCTGTTCGAAGATTGCGGTGTACTAGAGAGTTTTAAGCCACTT
TACGGTTTTGGTGAGAAGGATACTTATAGTTACAAAAAGAAACTGAAAAGAATGAAGAAG
AAACAAGCCAAGAGAGAAAGCAATAAGAAGAAAGCCATCAATGAAAAAGCCGAACAAAAC
TGAACTTCCATTATCCTGTATAGCTCTACTGTATAAACCTTCTATATTGTAACCTCATGA
ACTCGCACATGTACAAACCTTCAAGAGAACCGGCACCAAAGCGCTACCATCTGGTTGCTT
CATCGCTTATAGTGAGTAGTTTTAGATTTGAAGGTTATCGCTCCTGGCAAAAATCTGAAT
CCACACACCGCATAATTAGCGGTTATTATTACTCAATTTCCGGCCGGCTTTAATATACTT
TCACCGAAAGGTCTCTATATAGAAGCTATTTGCTGACACTTGCTTACAGGAATCGATTAT
ATAAGAAGGGTTCTGCATCTGGTTGCCTACTTAGTTTTCGGTATTTTTGAAGATTAGCAA
AAAGATCAAGATATCAAGTATTTTCATATTTGTCATTTTA
Chr coordinates Chr XVI from 369441-368071
w3c xhtml validator w3c css validator