Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CAR1
Systematic Name YPL111W
Alias arginase, cargA, LPH15
Strain S288c
Description Arginase, responsible for arginine degradation, expression responds to both induction by arginine and nitrogen catabolite repression; disruption enhances freeze tolerance
External source Open in SGD external link
Gene Sequence
Download FASTA
Hide Seq
>CAR1 YPL111W
ATGGAAACAGGACCTCATTACAACTACTACAAAAATCGCGAATTGTCCATCGTTCTGGCT
CCATTCAGCGGCGGTCAGGGTAAGCTTGGTGTCGAGAAGGGCCCTAAATACATGCTTAAG
CATGGTCTGCAAACAAGCATAGAGGATTTGGGCTGGTCTACGGAATTAGAGCCCTCAATG
GACGAGGCCCAATTTGTGGGAAAGTTGAAAATGGAGAAGGACTCCACAACTGGGGGTTCC
TCTGTTATGATAGACGGTGTCAAGGCTAAAAGAGCAGATTTGGTTGGTGAAGCCACCAAG
TTGGTGTACAACTCCGTGTCGAAAGTGGTCCAGGCGAACAGATTCCCCTTGACCTTGGGT
GGTGATCATTCAATAGCCATTGGTACTGTATCCGCGGTTTTGGACAAATACCCCGATGCT
GGTCTTTTATGGATAGACGCCCACGCTGATATAAACACCATAGAAAGCACCCCCTCTGGA
AACTTGCACGGCTGTCCCGTGTCATTCCTAATGGGTTTGAACAAGGATGTCCCACATTGT
CCCGAGTCGCTCAAATGGGTTCCAGGCAACTTGAGCCCAAAAAAGATCGCGTATATTGGG
TTGAGAGATGTTGATGCCGGAGAAAAGAAAATCTTGAAAGATCTGGGTATCGCCGCCTTT
TCCATGTACCACGTTGACAAATACGGCATCAACGCTGTCATTGAAATGGCAATGAAAGCC
GTGCACCCAGAAACAAACGGTGAAGGTCCCATTATGTGCTCCTATGACGTCGATGGTGTA
GACCCATTATACATTCCTGCTACAGGTACTCCAGTGAGAGGTGGGTTGACCTTGAGAGAA
GGTCTTTTCTTGGTGGAAAGATTGGCCGAATCCGGTAATTTAATTGCGCTAGACGTTGTT
GAATGTAACCCTGATCTGGCTATTCATGATATCCATGTTTCAAACACCATCTCTGCAGGT
TGCGCCATTGCAAGGTGTGCATTGGGTGAAACCTTATTGTAG
Promoter Sequence
Download FASTA
>CAR1 YPL111W
TACCGAGCAAATTCACCAAAATATTTACATCCAATTTGCTCCCCTCACTCTTCCCCGATG
TCGGTTGTGATTACTGCTACGCATGGCGACTCTTAATTTCTTTCAGGTATAGTAACATTT
ACTCCTTTAAGTAATTGTCTATTTTTCCTCGACACTGTATGTAGTTACCTTTCAAGGAAG
CTATTCCAATACCATCGTGAGAAAAACTCTATTGGATACTTCATCTAGCTCGTATATATG
CTTTTTAAACTTTATACCAAACCGTGTAGGCAAAACTGGACCGCCCGGTAAGTTCTGCTA
TTAACAAATTAAATAAAATTGGCCAAACTGAGGATTGACAGTTCTGAATATCCAAGATTA
CTGACTTCAATTTTCTCACTTCTCATCATAATATTCCGCTGATTTTTACATACCGTATAT
CCAATTTACGGCCCTTCACATATAGCGGCGAAATGATGGTAAAGCTACGCATACTGTCTG
ACAGGACCCTATTCTAGCAACCTTACATGAAACAAAAACAAACAACATCACATCATACGG
ATGAACTACGGGTGCAATCCCTGACTCATCAATGTTTATCATAAACTTAGATATCAACAC
TGATAAACCCCACCTCTATTTTTACTGGTTCTTCACTTTTTCGATGCCGCACCGTCGCCC
GCGATCCCCGCCCTTTGATTGCTCCTTCCATTAACAGTTTTTTTCTATCCCTTACAAGAA
GCCGAGACGCCGCGAAAATATCGGCTAGTGCGAATAGTCTCTAGCTCTTGCCCTTCGCAA
AGCACCGTGCTGCTAATGGCAATCAACAGCGCATCGCCGCTCGCTGAATTTTTCACTTAG
CGGTAGCCGCCGAGGGGTCTAAAGAGTATATAAGCAGAGCTTGCGGCCCACTTTCTATCA
AGATCTAAGACTGTTTCTCTTCTCTTGGTCTGTATATGTTTTCTCAAAGTTAGCAGAAAC
AACAACAACAACTATATCAATAACAATAACTACTATCAAG
Chr coordinates Chr XVI from 339944-340945
w3c xhtml validator w3c css validator