Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PEX25
Systematic Name YPL112C
Strain S288c
Description Peripheral peroxisomal membrane peroxin; required for the regulation of peroxisome size and maintenance, recruits GTPase Rho1p to peroxisomes, induced by oleate, interacts with Pex27p; PEX25 has a paralog, PEX27, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEX25 YPL112C
CAAAGGGCGGGGATCGCGGGCGACGGTGCGGCATCGAAAAAGTGAAGAACCAGTAAAAAT
AGAGGTGGGGTTTATCAGTGTTGATATCTAAGTTTATGATAAACATTGATGAGTCAGGGA
TTGCACCCGTAGTTCATCCGTATGATGTGATGTTGTTTGTTTTTGTTTCATGTAAGGTTG
CTAGAATAGGGTCCTGTCAGACAGTATGCGTAGCTTTACCATCATTTCGCCGCTATATGT
GAAGGGCCGTAAATTGGATATACGGTATGTAAAAATCAGCGGAATATTATGATGAGAAGT
GAGAAAATTGAAGTCAGTAATCTTGGATATTCAGAACTGTCAATCCTCAGTTTGGCCAAT
TTTATTTAATTTGTTAATAGCAGAACTTACCGGGCGGTCCAGTTTTGCCTACACGGTTTG
GTATAAAGTTTAAAAAGCATATATACGAGCTAGATGAAGTATCCAATAGAGTTTTTCTCA
CGATGGTATTGGAATAGCTTCCTTGAAAGGTAACTACATACAGTGTCGAGGAAAAATAGA
CAATTACTTAAAGGAGTAAATGTTACTATACCTGAAAGAAATTAAGAGTCGCCATGCGTA
GCAGTAATCACAACCGACATCGGGGAAGAGTGAGGGGAGCAAATTGGATGTAAATATTTT
GGTGAATTTGCTCGGTACGCGCTAAACTCACATGATTTAGCAGCGCCGTGGCGCAGTGGA
AGCGCGCAGGGCTCATAACCCTGATGTCCTCGGATCGAAACCGAGCGGCGCTAAATTTAT
TTTTTTCTTTTTACTCTTCATTTTTTTTCCAGGTCGGTGATAGTATATGAAATTCCGGTG
GGATTGGGCTTATTATTTCAGGTTATATAATTTTTGAAATACGTTTTTCTTCTTTCTTCT
CAGAATCATCGGTAATTTGTATGCTGGAGAAAGTAACAAATAGAGTCGATATCCTCAACT
TCCCTGTAAGTCTTCACCTATAGAAACTGGTCGTAAAACA
Chr coordinates Chr XVI from 338620-337436
w3c xhtml validator w3c css validator