Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name IDI1
Systematic Name YPL117C
Alias BOT2, LPH10
Strain S288c
Description Isopentenyl diphosphate:dimethylallyl diphosphate isomerase (IPP isomerase), catalyzes an essential activation step in the isoprenoid biosynthetic pathway; required for viability
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>IDI1 YPL117C
GCTTTTGCAGATTCCGGTATTTGTGCGGCAGCTCGAGCTGCCGATATGACATTAGGGTTA
TTTTGAACAAATGCTTGAAATTGCTTATAAAATCTCTCCAATGGATCTGAATGCTTGGAA
GACATATTATATCGTCGAATTTCTCTGTTTACTTCCAGAGCCCTTTTTTTCGTTATATTT
TCAGTGACTTAAGAAGTATTGGAGAAACTGAACTGATCAACTCCACACGAAAAGAAAGTT
TGTAATTTGGAAAAGGACTAGTTTTTCAAAAGAGAAGATCTGATAATAGATCAAGCGATA
AAAAAATTAACAAGATCTTATTGTTCAATTCAGAAAAAAACGTAAACAAAAAATAGTTCT
TCATGTTTAAAGGAAAGAGTAAAATAGTATTATCCCTTGATTAGTTGTTTACAATTCTTG
AAACTTTCCCAAACTGTTGTTTACATTTCTCTAAAACAAAAATAAAAACATGAGCAGGGT
AACACTCAAGGGTCCTAAAAAAATTAGGTTTTATTACAGAAATTGTATAGGACATTTTTA
ATATTACGAGGGTAAATAAATAACAGTCACAGAATAGTATAGGTTATTAAGGGCTTCATG
CGGCTATTTTGCCTATATTAATTTCTTTTTTTTTTCTTTTTTCTTTTTTTCCGCTGCTAT
CGGTAAAAGTTTCCGTTCTTGCTGGAACGAAATGGACAAAACTTAATTGTGATTGAAATT
TTTCCAGTCAACAGTTTCGCAATGACGATGCCCAGCCGATTCTTTTCCCTTTAATTGTTA
TTAAGAAACATGATTATTCATAACTCTTTTCTTGTCGATGGGGGTTGCCTTTCTTTTTCG
GTCTTAACTCCATTTATATTTATTTATTCATTTTTATCTATTTAACAGGAAACAGTTTTC
TAGTGACAAGAAGGCGTATATCCCACTTAATTCAATATTAGAGTATTCGTATTTGGAATA
CAGGAAGAGTAAAAATAAGCCAAAAATTCATTACACCTCA
Chr coordinates Chr XVI from 328730-327864
w3c xhtml validator w3c css validator