Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ISU1
Systematic Name YPL135W
Alias NUA1
Strain S288c
Description Conserved protein of the mitochondrial matrix, performs a scaffolding function during assembly of iron-sulfur clusters, interacts physically and functionally with yeast frataxin (Yfh1p); isu1 isu2 double mutant is inviable
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ISU1 YPL135W
GTAGAAGGCCTCGATGGCTTCGTATTTGTCTTCCGTCTACTCTTACCTTTATACAACCAA
TCTACGGGCACATCGAACTCGGTGTTAGTTATCATAACCTAGATGCTATCTCCACTCCCT
ATGCTTGCTTTGGTGGACTATTGTTTCCGTTATTCGCAATTTCTATAGGACTACTATAGA
TTATATAAACTGAATTTTAGCTTTATGCTGTGGTGTTATTTCCCAAAACACGCTCTTCTT
TCTTACGCTTTCCGTTAGCTTATTTGCTCACGGTATCAAGATTACTTTTTTTTTTTTTTC
TTCTTTTCTTTTTCTTGCACTACCCTCTTCTTCTTGTTCTTCCTTGCGTTTTTACCCCTC
TTCCCTTTATTTTGCAGCAAAAAGAAAGATGGAAAGGCAAAAGTGAAGGCATGATGATGA
CAAACTTGAAAAGAAAGAGAACAGCGAAAAGAGATGAATAATCCATGGCAATGACTGCAC
GCTCATGGGTATCAATTGGCTAGGTCTAATATTGTTATTGTTTGGAGTATGGCGTAGAGA
AGTGGTTCCTTAACCTTAATTAATGCCCGTGCCATGATGATTGCATCACTGAGACGTAAT
GTGGAAACACCACTTCTCGGTCCGCGGACATCAACCGAAGGAAAAATGACAAGCTATTTC
CGTGTATATCCGCGCCAATCCCTTCGGGGCCGAAGTTCGGAGGCTTTATCTCCGCTTAGC
CAAGGCCGTCAAAGGCGATAAGGTGCGTTGCACCCCAATTAGCCATGGAGAAGGAAAAAA
AAAGCATGTATGATCATGATGATGCAAAAATTGAGAGGAAAAATGACTCAGGCTATTTAT
ATAAGTAAATGAAAGGGTTTCGTTGTAGCCTTTTCTGCTCTCTTCCTTCGCTCTTCCGCA
TATATATTTGTGTTCAGAGATTATTCTTAAATCCATAAGAACATCCCTTCATATAACAAT
TGAATAAGGAAAACACAACACATAACACATATTTAACCTG
Chr coordinates Chr XVI from 297553-298050
w3c xhtml validator w3c css validator