Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ISU1
Systematic Name YPL135W
Alias NUA1
Strain S288c
Description Conserved protein of the mitochondrial matrix; performs a scaffolding function during assembly of iron-sulfur clusters, interacts physically and functionally with yeast frataxin (Yfh1p); ISU1 has a paralog, ISU2, that arose from the whole genome duplication; isu1 isu2 double mutant is inviable; human homolog ISCU implicated in mitochondrial myopathy, can complement isu1 isu2 double mutant
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ISU1 YPL135W
GTAGAAGGCCTCGATGGCTTCGTATTTGTCTTCCGTCTACTCTTACCTTTATACAACCAA
TCTACGGGCACATCGAACTCGGTGTTAGTTATCATAACCTAGATGCTATCTCCACTCCCT
ATGCTTGCTTTGGTGGACTATTGTTTCCGTTATTCGCAATTTCTATAGGACTACTATAGA
TTATATAAACTGAATTTTAGCTTTATGCTGTGGTGTTATTTCCCAAAACACGCTCTTCTT
TCTTACGCTTTCCGTTAGCTTATTTGCTCACGGTATCAAGATTACTTTTTTTTTTTTTTC
TTCTTTTCTTTTTCTTGCACTACCCTCTTCTTCTTGTTCTTCCTTGCGTTTTTACCCCTC
TTCCCTTTATTTTGCAGCAAAAAGAAAGATGGAAAGGCAAAAGTGAAGGCATGATGATGA
CAAACTTGAAAAGAAAGAGAACAGCGAAAAGAGATGAATAATCCATGGCAATGACTGCAC
GCTCATGGGTATCAATTGGCTAGGTCTAATATTGTTATTGTTTGGAGTATGGCGTAGAGA
AGTGGTTCCTTAACCTTAATTAATGCCCGTGCCATGATGATTGCATCACTGAGACGTAAT
GTGGAAACACCACTTCTCGGTCCGCGGACATCAACCGAAGGAAAAATGACAAGCTATTTC
CGTGTATATCCGCGCCAATCCCTTCGGGGCCGAAGTTCGGAGGCTTTATCTCCGCTTAGC
CAAGGCCGTCAAAGGCGATAAGGTGCGTTGCACCCCAATTAGCCATGGAGAAGGAAAAAA
AAAGCATGTATGATCATGATGATGCAAAAATTGAGAGGAAAAATGACTCAGGCTATTTAT
ATAAGTAAATGAAAGGGTTTCGTTGTAGCCTTTTCTGCTCTCTTCCTTCGCTCTTCCGCA
TATATATTTGTGTTCAGAGATTATTCTTAAATCCATAAGAACATCCCTTCATATAACAAT
TGAATAAGGAAAACACAACACATAACACATATTTAACCTG
Chr coordinates Chr XVI from 297553-298050
w3c xhtml validator w3c css validator