Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL33A
Systematic Name YPL143W
Alias eL33, L33A, L33e, l37A, rp47, RPL37A, YL37
Strain S288c
Description N-terminally acetylated ribosomal protein L37 of the large (60S) ribosomal subunit, nearly identical to Rpl33Bp and has similarity to rat L35a; rpl33a null mutant exhibits slow growth while rpl33a rpl33b double null mutant is inviable
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL33A YPL143W
TGGGTCAAGATCATCGCGCCATTAAATATCGCAACAAATTCCAAAGGAAGTTATCACAAT
TGCAACGGCAAAGCAAAATTTTATTCAAAATTATAGATGGCCGAACCGCTAAGGATTGCG
GACCAAGCTAATTTAAATTCGATTTCATTTCCTCACTCTGGGGTACAAAGGTTATGGGGC
TCATCAACCAAGTTGGATTCAGTGGCTCTTTTGAAGAGTCAAAGAGTGACGATTCCTATA
GAAATGATCCTACTGTTGAATGTGTTAGTCAAAACCTGAAGCTGGTGAAATAGAAGATGG
TTGTTGAATACGACAATCGCATTGCCTAATTATTGGGTATGCTTTGTTATATTCCTAATA
AAGTATATGGTATAAAACATACTGAAGTACGTCGACAATTTTTTTAGTAAAAAGAACAAG
AAGAGAATAAAACTAAGAAAAGGATGAATGAGTGAAGTTATCAAGTTGTTTGGAAAGAGC
TCACTATTTATATGTTTCTTTAACTTTACTCATTCACCTCATCGAGAATGGAAAAACTAA
TGAAAAATTCAGCCCTAAGAAAAATGCTCGAAATACATATCGTAGTAGTTACCCACCTCT
CGTTGCAATTTTTTCCACGGCAATATTAACATCCTTACCTCTTTACACCCTTACACTTCC
TTTGATTACTTTTTTTTTTCTTCTCTCAGTTTGTTTCGCGTACACACCTTGGGTGCCCGT
CGAAGAATTCTCCGCTCAATGGAACGTACGGAGGTCATACTCAGCTTCCCTCTAGCAGTA
CAGTCGTTAGACAGAGCTGATTCATCTTTTCCGGCCTAAACTCGTATCCTGTCCCTCCCT
TCTACTCTTCACCGGCATGATACCTTTGCCTCCCGTTTGGCAAAATATTCGCTATCAAGC
TTTAATTTACGTGTATTAATCACTAGTTCAAAACTTGAGTTATTTTGCCTTGAGCAATTG
TAAGAATCCGTAAGAAACCAACAATCAAATAAATTGAAAA
Chr coordinates Chr XVI from 282122-282140,282666-282970
w3c xhtml validator w3c css validator