Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name KES1
Systematic Name YPL145C
Alias BSR3, LPI3, OSH4
Strain S288c
Description Member of the oxysterol binding protein family, which includes seven yeast homologs; involved in negative regulation of Sec14p-dependent Golgi complex secretory functions, peripheral membrane protein that localizes to the Golgi complex
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>KES1 YPL145C
TGAGGTTAATATGTCTATCCCTCATTAAGGGAATGGCGTAGTAATAACATGATAAGGATG
AAGATGAATTCAGCGAGGCCTCTTGTTTAAATCCCACTACCAGACTAATAGGTATTTTTT
TAGAACGATCGTCTGCAGGTAGAGTAGCAATAACATCCAGCGTCGGCTGTAGAAATCCAG
ATTCTGATTCAATAGTTCGGCTAATCGTCTTTACTAACATCACAATCACTCGCGTCTAAT
CTCAACGGAAGCATCTTTTGCAATTTCCCGGTCCAAATCATTTGTAAAACATAAACAATA
TACCAGAACCTAATCTTTTAATGTACTTTCATGTCAACAGTAAATTTTCAATCCGGGCAA
CGAAAACTTTCGTGCAAATAATTTCCGGAGCTCCTAAACGAACTAAAATAAGCTCTTTCC
CGTATGTACCTCATCTTGTTACAGCACGAAGAATAATCGCACCGACCATTGTGTCAATCA
CTTCACGGGACCAGTAACTCATTCCGTTCGCGTTTTACTAGCTGCAGCATTTTTGGGCCC
TCTCACGTAAGTCATTATCTTTCGGAATTGTGAGGTGCACGGATGCGGACTTCTCCTTTT
GCCATTGCGTTCGTTGATTATTCTTGTTTTCCAACCTTTGCCCATTTCCTGGACTACTCG
ACAAGTACCACGTTTATTGGGCTCTGGTTTATTTTTCAATAGTTCTGTCTTGAGCTGTGC
AAGTATTACTATTCCAAGTAAAACGATATTTCGTCGATAAGTTCTTAAGTAAACTTTTCT
TTGAGTTTGACTCTATCACATTGGCTTTTTTTTTACCCAATTTCTAGCTGTTGTACTAAA
GAAAAAAACAAAGAAAGAAAACTATACATTGGATAGAAACTGGCTATTTGTTCACGCTTT
CAACGAAATCACCAGTCTGAACATAACAGAAATATATCAAACTTTTCTCCTAGAAACAAA
TCGAAAAATTTATAAGATTTAGTCTCAAGAATTTCAAGTC
Chr coordinates Chr XVI from 279699-278395
w3c xhtml validator w3c css validator