Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name ATG5
Systematic Name YPL149W
Alias APG5
Strain S288c
Description Conserved protein involved in autophagy and the Cvt pathway; undergoes conjugation with Atg12p to form a complex involved in Atg8p lipidation; conjugated Atg12p also forms a complex with Atg16p that is essential for autophagosome formation
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>ATG5 YPL149W
CAAGAACAGATTCCTTTTACGATATCACTACAGCTACACCAGTTGTGACCACTGATAATA
GGCGCAATAAAAACAATAATCTGAAAGAGTCTGTTTTGCCCAGATTTGGGACTCAAAGGC
CATGGACTGGCAAAAGGACGTATACCACGTCCCGCCATGGCAAGAATGCTAGGCGTTCGT
CTAAAAGAGGTCTGTTCAAAATAACTTCTTCAAATACAGACTCTATTATTCAAGAAGTAA
GCTCATCAGAAGAAGAAGATCATAATGTTATCTATAGCAAGGGAAAGGGTCTTCCAACAC
CAGTTTTGCAAACTAAAGGATTAATAGAAAATGGGTTGAACGAACGCGATGAAGAAGGAG
ATGACGAGTATGCAATTCACACTGACGGAGAATTTTCTATCAAACCGCAGTTTTCCGATG
ACGTTATCGACAAACAGAATCATTTGCCCAGCGTGAAGGCTGTGGCAACTAAACGTTCGT
TGAGCGAAGGAAGTAATTGGTCTAGTAGCTATTTGGATTCGGACAATAATCGGCGAAGGG
TATCTTCATTGCTAGTAGAGGATGGGGGGAATCCTACAGCGTAGGTACCGGATAACAGAG
TAACTGGTAAAAACGGCAAAAAATACTGTAAGGAAGTTGTCTATATATGTACATATGGAT
ATTGCGGTATAATAAAAAAGCTTTAAAATTATAAAGAAACCCGACTTTTATCACATATAA
TTATATTATAAAAAAATAATGGCATCTGTATGAACTCGCGATTAAGCTCACTTTTTTCTA
ATGATCGAAGTTTTGTCCGGTTATCCAACTGTGGCAAGAACATCGCGAGGCGGAGCTAAA
CACAGAATTTTTGTAGCGCGATGAGAAACATAACGCCTCTTTAGATAAATTATCATCACC
TTTTTTACACTAAATAATGAAGTAGCATGCTCAGAAGTGCGAATGAATTTTTGTTCTTTT
GGTTCTAGAAGAACGGAGATAGGAAACCTATGATGTAAGT
Chr coordinates Chr XVI from 271310-272194
w3c xhtml validator w3c css validator