Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRP46
Systematic Name YPL151C
Alias NTC50
Strain S288c
Description Member of the NineTeen Complex (NTC) that contains Prp19p and stabilizes U6 snRNA in catalytic forms of the spliceosome containing U2, U5, and U6 snRNAs
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRP46 YPL151C
CCCTGGGCAATATTCTAATGCCATCCACACTTTTGATTCTGTCACTATCACTTCATAAAG
CTTTGTAATATAAGGAAAATCGAACTGTCTATGGTAAAATACCTCTCTAACGATATTGGG
ATCATTCTTATCACTCGTCTTTAGGCAGACTTTACGATGTGTTGGTCTATGGAGCGCTAA
ATATACTTTTCCAAAACTTCCTTCACCTATTTGTTTTAAAATCTTGTAGTTTCCCACTTC
TGTCAACTCATCAGAAGTAAATTGGCTGTATAGTCGATTGTACGATGATCCTATAATGCT
TTTTATATTGTTTTGTTCCAATTTCGAGGATCCAACAGGATTAACCATGGTGAGCAGTAT
ATTCACCTATATGTGGGTCTTTTATTGTCTCTTGGCAACGGATAAGGAGAACTTGCTTCC
ACTACACAGTGACTAGTTATTAATGAAAAACGAAACAAAATTTATTGATACAAAAAATAG
TATTCGGATAACGAAACTCTTGTTGACTTCAAAATACAGGTATTGGAATTTTCGTAATGA
TTCGGAATGATATGAGGGAAAAAACGTTACTTTATTTAATTCATACAAGATATTTATTGT
ATACCGTTATTGATAAGTGTTCTGTTGTCAAGATTGGGAGGGTCCACGCGGTCAACATTG
TTAAGATAAGCCGAAAATCACCACACAAATCCACGATGACCTAAGAACATTCGTTCGCTT
AAATCACCTATAGTCACAATAAAGTAGCATTCAATGTGACAAGAGGAGCTATCTACTTTC
AGAGAATTACTCCTCATCTCGTATTCCTATTTCGAGTTCAACAACTCTTTTATTAAGTAA
GGGTGCTCAAAATTCTTCATCATCTAATACGGAAAAGCTACAATTTTGGCAATAAAAGAT
TATTCAAGATGTGAAGCTAACAGTAATTATTACCCACTTCATTGCATCTTAAAACCATTT
CCGAGGATGCAGACACTGTGTTACATGGAGATTAGTGAGA
Chr coordinates Chr XVI from 267535-266180
w3c xhtml validator w3c css validator