Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PEP4
Systematic Name YPL154C
Alias PHO9, PRA1, yscA
Strain S288c
Description Vacuolar aspartyl protease (proteinase A), required for the posttranslational precursor maturation of vacuolar proteinases; important for protein turnover after oxidative damage; synthesized as a zymogen, self-activates
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PEP4 YPL154C
GCCAGTTAGCGATACAAATAATAACGGCAATAATTCGGTACTAAACGACTTGGTAGAGTC
ACCGATTAATGCGAATACGGGGAACATTTTGAAGAGAATACATTCGGTAAGTTTATCGCA
ATCACAAATTGATCCTAGTAAGAAGGTTAAAAGGGCAAAATTGGACCAAACCTCAAAAGG
CCCCGAGAATTTGCAATTTTCGTAACCAAGGACAAATACCCATAGAAAATGCTGCCCCTT
TTTAAGAGAGAAGATGGTAGATACCAATACTCAGAATTCATCTATTCATAACTTTTTGGG
TTTTTATTACATATAGAGTGACGTTTTGATACGATTTACATTTTGAAATATATAGATTTT
TGTATATTAATAAGTTTTGATTTTCAGTTTTAGTTATGCTTAATGAATTTTTGAATCAGA
AAAAGAAGTTCTGAAAAAAACATAATCCTGCTTGATGTGGTACAACAAGCTCATAAATAA
TTTTAAAAAGTTTGTTAATCCGTTTTCAATATCTTGAGCTCCTCAATTGTATTTGCTGAG
GTCTGATTATTTCTATAACCAAAAGCGGTTATTGAATCTATGGAGAGGCTGTAACCCGTC
TTATGCCTTCCGGGTACTATATTTCATTTGCGGGTGTCGATGGATTAAGGGGCGGAGGCG
GCCCTTTTTAGGATTTATATAAAAAGCCATACTTCCGTACTTCGTAACCTCTTATCAACT
GGTTAAGGGAACAGAGTAAAGAAGTTTGGGTAATTCGCTGCTATTTATTCATTCCACCTT
CTTCTTTTTTGAGCGAAGCCTTTATAATCAAATTTTAGTGGTCTTTTCTATTTTTATTTG
AGAAGCCTACCACGTAAGGGAAGAATAACAAAAAGTATATCTCACCCTACTGTATTCATA
AAAAGTTTTTTCTATTAGAATTCTATAAGAAAAGAAAAAAAAAAAGCCTAGTGACCTAGT
ATTTAATCCAAATAAAATTCAAACAAAAACCAAAACTAAC
Chr coordinates Chr XVI from 260931-259714
w3c xhtml validator w3c css validator