Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PRM4
Systematic Name YPL156C
Strain S288c
Description Pheromone-regulated protein proposed to be involved in mating; predicted to have 1 transmembrane segment; transcriptionally regulated by Ste12p during mating and by Cat8p during the diauxic shift
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PRM4 YPL156C
GAAGAACAACGTAGGATGATCTCTGAATTGAAGAACCGTTCAAACATTGGCGAGCCCTTA
ACCAAATCTTCCAATGAAAGTACTTATAAAGACATTAAAGCCACCGGCAATGATGGTGAT
CCGAATTTGGCTCTAATGAGAGCGGAGAATCGAGTATTAAAATATAAACTAGAGAATTGT
GAAAAACTACTAGATAAAGATGTGGTTGATTTGCAAGATTCTGAGATTATGGAAATTGTA
GAAATGCTTCCCTTTGAGGTCGGCACCCTTTTGGAAACAAAGTTCCAAGGTTTGGAATCA
CAAATAAGGCAATATAGGAAATACACTCAAAAACTTGAAGACAAGATCATGGCGCTAGAA
AAAAGTGGTCATACTGCAATGTCGCTAACTGGGTGTGACGGCACTGAAGTGATCGAATTA
CAGAAGATGCTCGAGAGGAAGGATAAAATGATTGAGGCCCTGCAGAGTGCCAAACGACTG
CGGGATAGGGCTTTGAAACCACTCATTAATACACAGCAATCACCGCACCCTGTCGTGGAT
AACGATAAATGATTAGGTGAGGGTCCCAGATCTCGGGTGCTTTTTTCCTTGTGCGGATTG
TTCTGTAGACTGCGCCTCCGCTTGCCCGGCGCTTGCCTTGAACGGGATCTATTCTCAGAA
GACAGCGCATAAAAGGCAGTTTTTAGGCACTTCTCGTTAAGAAAATACACAAATAATGGA
TTTACGAAGTTCGTTTCAGTGTGGTACCAAAAAATTTGGCATCAGCTAATAAAGATCAAG
AAGTTTTGGGGTTGTTTCGAGTCTGTCTCGGCCTTAATTGTGCAGGTACTAAAGGGATTA
ATATATAAAGATTGTTAAGGCCAAGTGACTGAAACTTGCAAACGTCTTTGAATCAGGCTT
ATCTCTTAAATACTTATATATATGTTCTTTTATAGACTTCATAATCTCTTGTTCCAAGAA
CAGTAAAGAGCAATTAAAAAAAGGAAAATAACAGTTAAAG
Chr coordinates Chr XVI from 256767-255913
w3c xhtml validator w3c css validator