Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SVS1
Systematic Name YPL163C
Strain S288c
Description Cell wall and vacuolar protein; required for wild-type resistance to vanadate; SVS1 has a paralog, SRL1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>SVS1 YPL163C
ATGATTTTCAAAATATTGTGTAGTTTACTACTGGTAACCTCCAACTTCGCTTCTGCCTTA
TATGTCAATGAAACTACGAGCTATACACCATACACGAAGACATTAACTCCAACATACTCT
GTTTCACCTCAAGAGACAACATTAACGTACAGCGATGAAACAACCACCTTCTACATAACA
TCTACTTTTTACTCTACCTACTGGTTCACTACCTCCCAATCAGCTGCTATTATTAGTACA
CCTACTGCAAGTACACCTACTGCAAGCACGCCTAGCCTAACTACGTCCACAAATGAATAC
ACCACCACCTATTCTGACACAGACACCACCTACACGTCTACTCTGACCTCTACTTACATA
ATAACTCTATCTACGGAATCCGCCAACGAGAAGGCTGAACAGATTTCCACGAGCGTCACA
GAAATTGCTTCTACAGTAACCGAATCGGGCAGTACATACACCTCTACTTTGACCTCAACC
TTATTGGTTACTGTATATAATTCCCAAGCTAGTAATACAATAGCGACATCCACAGCTGGG
GACGCCGCCTCCAATGTTGATGCCTTAGAAAAGTTAGTCTCTGCTGAACATCAATCTCAG
ATGATTCAAACCACATCCGCCGATGAACAGTACTGTAGTGCGTCTACCAAGTATGTTACA
GTTACAGCTGCTGCAGTTACCGAAGTGGTTACTACTACGGCGGAGCCTGTTGTTAAATAC
GTTACTATAACTGCCGATGCTAGTAATGTTACAGGTTCTGCTAACAACGGTACCCACATT
TAA
Promoter Sequence
Download FASTA
>SVS1 YPL163C
ATTCTTTGGTTGTGCTTATACATAATTGAAAAAGTGCTAAAATCCTTACACTTCCAAAAC
ATTGAAAGTGGTAATTATTTTCCATCTAAAACCGTTGGGAGCCACCCCAGAAAACCCTTA
TTCTCTGCCTTCGTGAAACAGCTGCTTATATTCATTGTTGGGCTGGGCGTGATGAAGTTC
TGCGTGTTTCTAATACTAAACTACTTAGAAGACTTGGCATACTGGTTCGCCGATCTTATC
CTTGGCTGGTCAGATTCATGGCCAAACTTTCAAGTTTTTCTGGTCATGTTTGTCTTTCCT
ATCTTACTGAATTGCTTCCAGTACTTTTGTGTCGACAATGTCATCAGGTTACATTCTGAG
AGCCTAACGATAACCAATGCAGAGAATTTTGAAACGAACACATTCCTAAATGACGAAATT
CCTGATTTATCGGAAGTCTCAAATGAAGTGCCTAACAAGGATAACAACATTTCCAGCTAT
GGTAGCATAATATAGTATTCCAAGGATAAGGAAAGCATGCACTGTTTATTTCCTTTCCTT
GCTTAATTGATTTTTTTTAAAGGGAACAAACATTTTGATTTCAATTTCCACAAGCCTAGA
CTCTTCAACACATAATCTGTGGGTTATTGTTTGGGAAAGCATTCTCCGCTAGAAGAATGA
AACTGGCGCTCAGGTTTGATTCTATAACTACGGCAGTTTTTCCTATTCTATTTTCGTTTT
TTGATTTTCCCGCCGCATTGGATATTCAATTCGCGACGCTAATAATTGGCATTTCGTGTT
CTTAAGTAATTTCGTGTTTCAAATAACCGTAAACAGAGAAAGACCCAAGAATTTCAGATG
GCTTAGAAGAGGTAGACATTAAATCAATCTGTATGTGATGGAGAGGGAGTGTATTTAAAA
GACGTAAGAAAATGAATTATCAAGATCCGTTATGGCCATCTAGTCTCTTTCTTGTACACT
AGTTGTCTAACACAACCAACAAATTAGAATATATATCGCA
Chr coordinates Chr XVI from 242700-241918
w3c xhtml validator w3c css validator