Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name MLH3
Systematic Name YPL164C
Strain S288c
Description Protein involved in DNA mismatch repair and crossing-over during meiotic recombination; forms a complex with Mlh1p; mammalian homolog is implicated mammalian microsatellite instability
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>MLH3 YPL164C
GTTCACTACCTCCCAATCAGCTGCTATTATTAGTACACCTACTGCAAGTACACCTACTGC
AAGCACGCCTAGCCTAACTACGTCCACAAATGAATACACCACCACCTATTCTGACACAGA
CACCACCTACACGTCTACTCTGACCTCTACTTACATAATAACTCTATCTACGGAATCCGC
CAACGAGAAGGCTGAACAGATTTCCACGAGCGTCACAGAAATTGCTTCTACAGTAACCGA
ATCGGGCAGTACATACACCTCTACTTTGACCTCAACCTTATTGGTTACTGTATATAATTC
CCAAGCTAGTAATACAATAGCGACATCCACAGCTGGGGACGCCGCCTCCAATGTTGATGC
CTTAGAAAAGTTAGTCTCTGCTGAACATCAATCTCAGATGATTCAAACCACATCCGCCGA
TGAACAGTACTGTAGTGCGTCTACCAAGTATGTTACAGTTACAGCTGCTGCAGTTACCGA
AGTGGTTACTACTACGGCGGAGCCTGTTGTTAAATACGTTACTATAACTGCCGATGCTAG
TAATGTTACAGGTTCTGCTAACAACGGTACCCACATTTAATGCGTGACGTTGAATCGAGA
AAAAAAGCTACTTTTAACGAAACCTTTACTAGTTATCCTATATGGGATCACTAGTATTTT
TTGATTTACGATTCAATAAATAGACTAGAGACAACTTTCATATCATTCCTTAAAAAATAC
ATAAAGCGCAAATTCAACCCCATTGATACATATATAAGTAGTTCTATTATGACTTTCAAG
AACAATAGTAGCTTTTCTAAATAATCAATAAGTAGCACAAAATCTGTCTGTTTGTACGCT
TATATTTAGTTTGCGTTTATTTGCGAGCGCCACGAGAAGGGGCAGGAAAAAAAGATCAAT
AGTTTGCAATAAACATCGAATGATGATTTCAACCACCGATACATAAACCAGCGAGGCTTT
CAAGGAAGAATGAACGTGAACTCGTCAACTCAAAAAGAAA
Chr coordinates Chr XVI from 241497-239350
w3c xhtml validator w3c css validator