Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name COX10
Systematic Name YPL172C
Strain S288c
Description Heme A:farnesyltransferase, catalyzes the first step in the conversion of protoheme to the heme A prosthetic group required for cytochrome c oxidase activity; human ortholog is associated with mitochondrial disorders
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>COX10 YPL172C
ACCGACGAATACGGCGGAACGATCGAAAACAGGGCCCGCTTTACACTGGAGGTTGTCGAT
GCTCTTATCGAAACTATCGGTCCTGAACGGGTGGGTTTGAGGTTGTCGCCGTACGGCACT
TTTAACAGTATGTCTGGGGGTGCTGAACCAGGTATTATCGCTCAATATTCGTATGTTTTG
GGTGAATTAGAGAAGAGGGCAAAGGCTGGTAAGCGTTTGGCCTTTGTGCACCTCGTTGAA
CCACGTGTCACGGACCCATCGTTGGTGGAGGGCGAAGGAGAATATTCCGAGGGTACTAAC
GATTTTGCCTACTCTATATGGAAGGGTCCAATCATCAGAGCTGGTAATTACGCTCTTCAT
CCAGAAGTGGTTAGAGAACAAGTAAAGGATCCCAGAACCTTGATAGGCTATGGTAGATTC
TTCATCTCTAACCCAGATTTAGTCTACCGTTTAGAAGAGGGCCTGCCATTGAACAAGTAT
GACAGAAGTACCTTCTACACCATGTCCGCGGAAGGTTATACCGACTACCCAACATATGAA
GAGGCAGTAGATTTAGGTTGGAACAAGAACTGAAATCATGAATAAAGACATTGATGTTAT
GTATTTTTCATATTCCTGCCATATTTTTAATTACAAAACTCACATATAGATATTTATATT
TGATACATCAATAATTATAACTTAAGGAAATAAAGATAGTTTTTGTCTTCACTTTTTAAA
GTATTTTAAACATCATCCAAGCCAAAAAGACTCGATCTTTGTTTATATAGGGCAGCTTTC
TCGTGCCCGCGCGCTGTTCAAAGGGAATAATAAAATGACTTTTTTATGCTTGCAAGCCCA
TTGACGTAAATCCACCGCAAGTGAGATTAATCAAAGAAGAAAATTCTTGATATCTGCAAT
AGACGTGATTCGGGCGTGATTAATATTCCTCATAGCGGGGTCTTTTTATTTTAGGCCTAT
AGTATCTCTTTTTTTCGATTTCTCCTTTTTTCCTCTTTAG
Chr coordinates Chr XVI from 225741-224353
w3c xhtml validator w3c css validator