Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CBC2
Systematic Name YPL178W
Alias CBP20, MUD13, SAE1
Strain S288c
Description Small subunit of the heterodimeric cap binding complex that also contains Sto1p, component of the spliceosomal commitment complex; interacts with Npl3p, possibly to package mRNA for export from the nucleus; contains an RNA-binding motif
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CBC2 YPL178W
CTTGTGTCTTCATACACTTAATATTGTTATCCTTCTTCAAGACCGGACTATATAAAGAAA
AAATTTTGTAATGCTATTATATTTCAACTTCAAATTATTTTCTACTAGTAGACATAATGG
AACTTCGCTCTCAGATAATCTATGGCGATAGATGGACAATTGACAATCTTCTGAAAGAAT
TTATATAATAAGATGTGACCATGACCTAAACCTGCTCACGCTCATGAAAGGATACAGGTA
ATTTGGCGAAACATTCCCAAGCTTCGCTGATAGACCTATCCCAGAAAGTGTCTGTTTAAA
ACTACAAGTATTTGCAGTTTTCGTTATCCAGTTTCGTTCAAGAGCATTAATGCACAAGCC
ACTTATATTATATAAATTTAAACTTTGGGAAAATATCATACACCTATTGTACCAGTAAAT
GTTGGAATAAAAATCAACTATCATCTACTAACTAGTATTTACGTTACTAGTATATTATCA
TATACGGTGTTAGAAGATGACACAAATGATGAGAAATAGTCATCTAAATTAGTGGAAGCT
GAAACGCAAGGATTGATAATGTAATAGGATCAATGAATATTAACATATAAAATGATGATA
ATAATATTTATAGAATTGTGTAGAATTGCAGATTCCCTTTCATGGATTCCTAAATCCTTG
AGGAGAACTTCTAGTATATCTATATACCTAATATTATAGCCTTAATCACAATGGAATCCC
AACAATTACATCAAAATCCACATTGTCTACAGTAAAAGTATACCACTAATAGATTTGTAA
TTGGTGTATGAAGTAGTGTATGGTATAAACGTTAATAAGTGCTTATCAAAGTATTACCCG
CTTTAACAGTTTTTGTGTTTTTTTCAAGAAAAATATTATATGTATGAATATAGAACATGA
GTTTATATGGAGAAAGTGTCTCGACAGCTTTTAAAGTCCCGAAAGGACTAATATCGAATA
AAAGTTGCATCCATTAATATACCAATAAATAAAGGGAAAG
Chr coordinates Chr XVI from 212158-212784
w3c xhtml validator w3c css validator