Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name GUP2
Systematic Name YPL189W
Strain S288c
Description Probable membrane protein with a possible role in proton symport of glycerol; member of the MBOAT family of putative membrane-bound O-acyltransferases; Gup1p homolog
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>GUP2 YPL189W
AAACTGCATCACACCAGATGCTTACCCATACAGAAAGTCGATTGATTATGAAACTTGAAG
TAGCGAAGATTACGGCACTCGAAAATAAATAAAAAGAGGAAATAAAAGAGATAGAATACA
ACTTATCAAAAGTTCCAGATAGCCCGTACCTGTTTAAATCTTTTTACTTAAAGCATCCTT
CCTCTTTAACTCCTGCTCATGAGCAAGCTGAAGCTTGTGTTGCTGTACAGCTGGTGAATC
AGAATCCACTGAATGTGCTGGACATGGCAGCACAGAACCGATGGCCACTGATGCGAATGC
AATGAGAAATGTAGAAAAGTATAGGTTATTGACTATTTTGTTTCTAGTGACTGCTCTCAT
GATATGTGTCTGAATTAAACTAATTGGCCTTCCGTGCCTGTAAATTCAATAAATAAATAG
GATGTTAAATTTTCCTAATGTGTCTCGAGGTGCTTATGTTATCGTGCAAGCGCTGAGTTC
GAAACGCTGTTTTGATGAATATCCTATATATATCAAAAGTACAAACACGGGGAAAGAGAG
CCATCCCATCAAAAAAAATAAAAAAAGAAAACCCTTGCAGAAGGAGAACTGGTGTAGAGG
TTTCCGGTCTTAATGGACTTAAGCACGTGACTTTTAAAACCCATGCATCGGTTACTATGG
TTACCATTACTTACGATTTTTTTTTTTTCGTTATGAACCCTGTGCCCGAGGGGTTTTCAG
GCACATAGATCAAAGTTCTACTCGTTTACCTGTAATCTTGGCGCGTTTAGGTCTCTTTTT
TTTTCTTTTTTTTTTCTTCTTTTTTCATTTGTACTGCGTTATAGTTGTTTATGGAAGGTA
CCAATGGTGAATATGGAAAAAATGAAGTCAAATAGAAGAAGAAAGAGAAGCTAGCTTTGA
GGTAGGTACTGTTTTGAGGGTTTTTGGGTGCTTCAAATTTGTCTTCTCAACTACCTTATT
ATAGGGCTCAAAAATAATTGACGTCATCGCTACAAGTCAG
Chr coordinates Chr XVI from 189154-190983
w3c xhtml validator w3c css validator