Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPL191C
Systematic Name YPL191C
Alias MIY1
Strain S288c
Description Putative protein of unknown function; diploid deletion strain exhibits high budding index; green fluorescent protein (GFP)-fusion protein localizes to the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPL191C YPL191C
CAAAACCTTCCACCTAACGTTGTATCGAATTTGCTTTCAATGGCCCAACAACAGCAACAA
CAACCTCATGCTCAGCAGCAATTGGTTGGTTTAATACAATCAATGCAAGGCCAGGCTCCT
CAACAACAGCAACAACAGTTGGGTGGATATTCCTCTATGAACTCATCCTCTCCCCCTCCT
ATGAGTACCAATTACAATGGTCAAAATATATCTGCAAAACCCTCTGCCCCACCAATGTCA
CACCAACCTCCGCCACCTCAACAACAACAACAACAACAACAACAGCAACAGCAACAGCAA
CAGCAACCTGCTGGCAATAATGTTCAAAGTCTATTAGATAGTTTAGCAAAACTACAAAAA
TAGACTCCCTTTTTTCAATCTTTTCCATTTCTTGTACATTATACTTGAATTCTTTTAATT
GGACGAAAAATTTTTAAGGAAAGTAGATTGATATGGTTTGCATAAATTCGACATAGCGGT
TTATGCTTTAATCGTTTTCCCTTCCCAAATTGGACTAGGACTTAATTCTTACTATTGCTG
CATCTCTTTCAGAACGAAAAACTCTTTACCCTGTTATAAATTTCTTTTATTTCTTCCTTA
TCAAATGCTATTTGGTCTATTTATTTCACTTACACGCACCTCTTCATTTGTTTCCTCTGC
CAAGAGAATGGCTTTTCATTTCTTTTTCTTCTCTTTAGTTAAATGTTCTTATATCAAAAC
TTTGTAAAATTGCTTTGTAAACAGATTATTAAGTACCGCTCTATTTACCCCATAACGAAA
AGAAGTTCCGCGCTTAGGACACCTTTCCCTAGAGGTTCTTGTTTGATTTGTTTTAGTCAT
CTGCCTGTCGTTTATTTTAGTTTCGCAGTATTAACAGCGAGCAGTACGAAAAAAGGGTCT
TGAAAACGTTGGACAAAATGCCCATTCTACAAGGCGCTTTAAAGAACAGCTCAAAGTAGA
TTCACATCACTGCAATTCTTGTTTATTGCAATATCTTTTC
Chr coordinates Chr XVI from 184679-183597
w3c xhtml validator w3c css validator