Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RPL7B
Systematic Name YPL198W
Alias L30, L6B, L7B, rp11, uL30, YL8
Strain S288c
Description Protein component of the large (60S) ribosomal subunit, nearly identical to Rpl7Ap and has similarity to E. coli L30 and rat L7 ribosomal proteins; contains a conserved C-terminal Nucleic acid Binding Domain (NDB2)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RPL7B YPL198W
TGTTGTTATATTGAGGATGTGGTTGTGCATTGTACTGATTAGTGGGGGCATTCACTGCGG
GGCCATCCATCTGCATTTGCACACCTTGCAACTCAAGCACCAAGACTCCTGAATTTCCTT
TTTCCAAATGGTTTCTGATACCATGCTTAGCACAGAACTCCTCAATTGACGGTTTGAGTT
TCGCTATACCGTTTTGAGAATGCAACCCTTTTCCAACAATAACGTTCAGTTGTGGTTCAT
TATGATCAATAGCGAATTTGATTCTTTTTTGGAGAATAAATAGGGCCTCTTTTACGTATA
ATCCATGTAAGTCAATTTCATTACTGGAAGAATCAGCATTGTTCTCTACAAACACATATT
CTGCCGCTTGCATGTTAAAATCTTCAGCGGTTTTCAGTTGTGCCTTACTTTTCTCGCTTA
GTTCATGAGCTAGCTTCTTGTCACCTTGTTGATAAGCGGTTTGCGATTCATGGCTGAGTT
GGTCTCTTTTCTTATACGCTTCATCTGCTAATCTTCTCAATCTTTGATACTCTTCATCAG
TGCTATGATTGTAGTCCCTTACAGGATTCTGAGTTCCGACTACTACTCCACCTGTTCCTT
TCATAGTTTTAAGTGCGGCGCTTTAGCTTCAAACTGACTCATGGTTGCGTAAAAACATGG
TTGCTTTTTGTCGTTTTCCTCGAAAGGCTTTACCTTTTCATTAAGCCGCTCCATTTTAAA
ATGTTTTAATAAATCCACTTTTTTCCGGCGCATAATGGATCCAGAAAGGAACTGGCAACT
AAATCCGTACATTTCTGAAATTATTTCAGTTCGCAGATTATTTTCTCAGTTTTACCGTAT
ATTCTTATGTATTACAGTTGAGGTACCCACACGCGCACTTGAAAAGTATATAAAAGTGAA
ATATTTCAGAGCTCTTCCTATTGCTTTTTCAATAGAGGCTTAAATCTTCCTCGTTTGTAG
AGTAAGTAGACCCATATTACAAATCTCCATCAACGTCATA
Chr coordinates Chr XVI from 173152-173162,173572-173665,174073-174702
w3c xhtml validator w3c css validator