Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name FAS2
Systematic Name YPL231W
Strain S288c
Description Alpha subunit of fatty acid synthetase; complex catalyzes the synthesis of long-chain saturated fatty acids; contains the acyl-carrier protein domain and beta-ketoacyl reductase, beta-ketoacyl synthase and self-pantetheinylation activities
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>FAS2 YPL231W
CCAGGACTACAGAATTGTGGATTCCAACTACAAGGAGGAGAATAAAGAGCAAGCCAAGAG
GCAGTATATGATCATTCAACCAGAGGCCACCGAAGATGAAGTTGAAGCAGCCATAAGCGA
TGTAGGGGGCCAGCAGATCTTCTCACAAGCATTGTTGAATGCTAACAGACGTGGGGAAGC
CAAGACTGCTCTTGCGGAAGTCCAGGCAAGGCACCAAGAGTTATTGAAACTAGAAAAATC
CATGGCAGAACTTACTCAATTGTTTAATGACATGGAAGAACTGGTAATAGAACAACAAGA
AAACGTAGACGTCATCGACAAGAACGTTGAAGACGCTCAACTCGACGTAGAACAGGGTGT
CGGTCATACCGATAAAGCCGTCAAGAGTGCCAGAAAAGCAAGAAAGAACAAGATTAGATG
TTGGTTGATTGTATTCGCCATCATTGTAGTCGTTGTTGTTGTCGTTGTTGTCCCAGCCGT
TGTCAAAACGCGTTAATTCCAACTATTTTCTATATTTCTATTCTATCCGAACTCCCCTTT
TGTATATCAATATATCTTAATACTTTCGCCTATTCTTTACTATATTTCCTAAATTTTCTC
TGGTCTGCAGGCCAAAAACAACAACTTACTACTGAATCATGGACGTGTATTTAGTTTAGC
CAAGCAATATTTAAATATCACTCTTCCTAAAAATACATTGGGCATTACCCGCAAACTAAC
CCATCGCTTAGCAAAATCCAACCATTTTTTTTTTATCTCCCGCGTTTTCACATGCTACCT
CATTCGCCTCGTAACGTTACGACCGAAATCTCACTAAGGCACGGTTTGTTGGGCAGTTTA
CAGATGTTGGATAACCAGTTGTTTCTAAACGGTTATGCCTCATATATAACTTGTTAACTG
AAGGTTACACAAGACCACATCACCACTGTCGTGCTTTTCTAATAACCGCTATATTAGACG
TTTAAAGGGCTACAGCAACACCAATTGAAATACCATCATT
Chr coordinates Chr XVI from 108652-114315
w3c xhtml validator w3c css validator