Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YAR1
Systematic Name YPL239W
Strain S288c
Description Cytoplasmic ankyrin-repeat containing protein of unknown function, proposed to link the processes of 40S ribosomal subunit biogenesis and adaptation to osmotic and oxidative stress; expression repressed by heat shock
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YAR1 YPL239W
TGTATCTAATTTTATCCAACGCATCCGAGGCATTAGATATCAGTTCTCTCAAGAAAATTT
CCTTGTTAGAATAGACGGTGTTGATGATCAAACTCATCAACTGAGTAATTTCAGCTTGAA
ATTCAAAAGTTTCACTAGCCATATCTTTGCGTGTTTGTTTGTGCTTTTGTTTATAGGACT
CTATTTTCTATCAGGTATGATTTCTTGAACTCTAATACAGCGGGAAGAAATGAGGAGGTC
ACAGATGTTAAGAATTGAAGGGATAAGCTGCATATTTATATGTTTTAGGGGGTGGCGGAA
GGACCTGGTTGGTATTAAGATGAGAATTAACCGCTCATAAAACCATGCGCGTGTTTTTCT
TCCACGGCGTTCTAGAAAAAAAAGAAAAATTCAAAAAGTTCTGCGAAACTCGAAAGAACC
AGAATTGTTCGAACAATATGTGACAAGCGTATGAGTTAATAATCCGATTAAGCTTTATTC
CTGTTCTTTTTTACGTGTATGTAAAACTGGTTTATGGATTACTGTGTTGAGAGAGGGGGG
GTGACACCCTCCGGAATGTGATATATCACACGCTTGCACGTTGGTTCATATCGTAACCAC
GAAGAATACAAATACGCACACGCAAGCTAAGTTATATTTTAAAATATTCTGTCATCAAGC
TTCCAAATACTTCTAACCATCTCTTATTCTCCTCTTAGTAGCCATTCTTTGCCACGAGGA
ATAAAAAGTCCCGCGCCACTAATTACAGGAAAAGAAAAATAGGACAATTCCATTTGATGT
CACCGTGGTAATATCACCATGAACGATGATATGAAATTTTCATAGAATAAGAAGGAAAAG
TAATAAAAGAAAAAGAGAATCTGAGAAAAAATCGATGAGTTAATTATCATTTGTGTAAAA
CAAAAACGAATTGTAATACGATAGGCAAAATTGTTCGCGCTCTATCTCAAAGAAAGTAAT
TATTTCCAAATAGAAAAAAAAAATCTACATATACGCAGAT
Chr coordinates Chr XVI from 99484-100086
w3c xhtml validator w3c css validator