Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name HSP82
Systematic Name YPL240C
Alias HSP90
Strain S288c
Description Hsp90 chaperone required for pheromone signaling and negative regulation of Hsf1p; docks with Tom70p for mitochondrial preprotein delivery; promotes telomerase DNA binding and nucleotide addition; interacts with Cns1p, Cpr6p, Cpr7p, Sti1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>HSP82 YPL240C
CACTTTCCTTACAAGTCGAAAGTAACTCGGGACTGACTAAAGTTGTAAATATATCTTTCA
GAGAATCCAAATCGCCAGCTCTTGCATCGAGTATTATGGTGTCTTGGTCCTCTTGATCTA
ACGGTTCACTGTGTAGGCCCATATCTGCGTATATGTAGATTTTTTTTTTCTATTTGGAAA
TAATTACTTTCTTTGAGATAGAGCGCGAACAATTTTGCCTATCGTATTACAATTCGTTTT
TGTTTTACACAAATGATAATTAACTCATCGATTTTTTCTCAGATTCTCTTTTTCTTTTAT
TACTTTTCCTTCTTATTCTATGAAAATTTCATATCATCGTTCATGGTGATATTACCACGG
TGACATCAAATGGAATTGTCCTATTTTTCTTTTCCTGTAATTAGTGGCGCGGGACTTTTT
ATTCCTCGTGGCAAAGAATGGCTACTAAGAGGAGAATAAGAGATGGTTAGAAGTATTTGG
AAGCTTGATGACAGAATATTTTAAAATATAACTTAGCTTGCGTGTGCGTATTTGTATTCT
TCGTGGTTACGATATGAACCAACGTGCAAGCGTGTGATATATCACATTCCGGAGGGTGTC
ACCCCCCCTCTCTCAACACAGTAATCCATAAACCAGTTTTACATACACGTAAAAAAGAAC
AGGAATAAAGCTTAATCGGATTATTAACTCATACGCTTGTCACATATTGTTCGAACAATT
CTGGTTCTTTCGAGTTTCGCAGAACTTTTTGAATTTTTCTTTTTTTTCTAGAACGCCGTG
GAAGAAAAACACGCGCATGGTTTTATGAGCGGTTAATTCTCATCTTAATACCAACCAGGT
CCTTCCGCCACCCCCTAAAACATATAAATATGCAGCTTATCCCTTCAATTCTTAACATCT
GTGACCTCCTCATTTCTTCCCGCTGTATTAGAGTTCAAGAAATCATACCTGATAGAAAAT
AGAGTCCTATAAACAAAAGCACAAACAAACACGCAAAGAT
Chr coordinates Chr XVI from 98625-96496
w3c xhtml validator w3c css validator