Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YPL245W
Systematic Name YPL245W
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to both the nucleus and the cytoplasm
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YPL245W YPL245W
AATCTTTAGTTCTGTCGATATCCTCATCTCTGTAATACTTAATTCCCCAAGGTATTAATC
GAATTAAACCGTCTAAACTTTTTTCGATTTTGGTGATGATCCATCCTGGTGGAGTGATCT
TGTTAAACCACGATTCCTTGTAGCCTATGGCGTAACCGACACATAAGCCGAAAAAATGAC
CCCAGAAACTGGAGCCAGGTATAACGACGGCAATTGCGACTAATAGTACTAGGGGTGTAT
ATAATGTCGGAATTGAGTAGTCTGTGCGAAAGATCCTTGTTCTAGGGCGGATCTGTGATT
CTTTAAAACTATAGTATGCGAATAAGGTGAAACACCACCCACTGGCGCCTGCAACTAATG
CTTCTGGATATAGCAACTTACCCAACAAACAGTACAGAATTCCGGCAAATAGAGCACTCA
GGTTCAAAAAAACACCTGTGTACACAGTCCCATGCGTTTCTTCGAAGAGATTCAAGGGTG
CCCAGATGGCTAGCACATTGAACAGTAAATGAGGCAATGATAGGTGAATTAAAGGATAAA
GCGATAGCCTGCTCATTTGCAGTTTGAACAATGACTCTGGCGCCAACGACAGGTCTTCCC
TTAGGGCAAAAATAAAACTTAACAGGTAAATAGCGGTTAGAAATACCACAAGGCCTGTGG
TCAACGCAGCTGGTGGATGACCACCGGGAAAAACGTACGACTTCCAATTCATAGCACGAC
CAAATAGCACAACCTAACAACCAGAGTGAATTGCTGTTCTCAGTGCTTCCAATTAAGCCT
TTCCCATCCCCCTATTCTTCTTGTATCGATGCAGTTCAAAAAAAAAAAAAAAAAGAGGCT
TTAGATCTCAAAGGGCCGAAAAAAGTGAAAAATTTTCTCGAGAAATCATAAAAGCAGCCA
TCGCCATATATAAACAATCTATGCATATGTATGCAGCATGGCATCGCATCTTTCTTGGCG
ACCCGGTAGTAGCATTTAACTTCCATTAGAACCATATAAA
Chr coordinates Chr XVI from 85586-86950
w3c xhtml validator w3c css validator