Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name RBD2
Systematic Name YPL246C
Strain S288c
Description Possible rhomboid protease, has similarity to eukaryotic rhomboid proteases including Pcp1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>RBD2 YPL246C
TTAAAGTGTACCAGTCTCTGGATTTTGGTGGAATCTCGTTGTAAAAGTCCTTTAAAGTGG
CACCGTTATTAGAACCTTCATCCCAATAGGAACCCATTCTTAAAGCTTGCTTATCATCGT
AAACCAATACAAGCACTTTACAAAGGGACATTAAGTCTTTGAGATGGTTTTCGCCATAAA
ATCTTTTGAAAGCATCCTTAGAAGTGGCCAACAAATGTGCTTCATCTACAATGACTACAT
CGGCCATGACTTTTCTCTTCTGTAGATTGTTGATCAACGAAGTGGGCCGTTCTAGTGACG
ATTTAGAAATATATTTGAAACTGTCACTAATCCGGATATATAACTTTAACATCTCGGGAT
GGTTGACTACCAGATAATTATGTGTCCCATGTAAGATATCTTCAGAAGAAGGTGAGAACT
GGGATAGTTTCTGAATTTCATTGAACAAGGAGTTTAGAATCACAGACTTGCCTGTACCTG
CGTCCCCTTGGATTACAAACATGGCCGGATGTTTCCAGTCAGACTTGTACTGAGATAAGT
TGGAACGCATGAACGACAAAACGCGCTCTCTCAACTTTTCTTGTTCAGCAGAGAGTGTTA
CGTTAGACAACTTGTTCATAGCCTGCGTGGAGACCACGGGCCTAGGTGCTCTTCTTGGTC
TCTTCACGCTTCTCACATTGCGGGAAATAGCTTTTGAAGTAGGCCCATGCATTTTATATG
GTTCTAATGGAAGTTAAATGCTACTACCGGGTCGCCAAGAAAGATGCGATGCCATGCTGC
ATACATATGCATAGATTGTTTATATATGGCGATGGCTGCTTTTATGATTTCTCGAGAAAA
TTTTTCACTTTTTTCGGCCCTTTGAGATCTAAAGCCTCTTTTTTTTTTTTTTTTTGAACT
GCATCGATACAAGAAGAATAGGGGGATGGGAAAGGCTTAATTGGAAGCACTGAGAACAGC
AATTCACTCTGGTTGTTAGGTTGTGCTATTTGGTCGTGCT
Chr coordinates Chr XVI from 85297-84509
w3c xhtml validator w3c css validator