Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name CLN2
Systematic Name YPL256C
Strain S288c
Description G1 cyclin involved in regulation of the cell cycle; activates Cdc28p kinase to promote the G1 to S phase transition; late G1 specific expression depends on transcription factor complexes, MBF (Swi6p-Mbp1p) and SBF (Swi6p-Swi4p)
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>CLN2 YPL256C
TTTTCGTGATTTTCACCGAGCGACACAAAAACGGGTCGCGTCAGAAATAATTTTAAAAGA
GCAGCGTAATATACCGCTACAGAAAAATTGGTTCAAGTATCCATTTTTAAGCATCTTTGC
TTCTATTTACTCTTGAAAATATTCCTCCAGTATCGCCTGTGTTGGAGTGCGGTAACTTTT
ATTGTTTTCTCTACGAGTGAAAGGCATTTTTTGAAACCACTATTCGTTTCCTTCTGTAAG
TTATCTCATCTTTTTCGTATCCTCCGCACTTTTACCCTGAAATGCGAACTAAAGCAACTA
TACATTGTTAATAATGATACTGAGGTTCAAAAGTGCCAAGTTATCAATTCATGCGCGCTT
TACCCGGCTCCATCTTTCCGAAAACGGAAATCATCGCGAAATTTGTCTCAACGGAAGTAC
ACGAAATTCGTCCCGCTGAACCTCAAAACTGCGTGTTCTAGTCACGAAACGCGCCAAAAA
CCGTTATGTTTCCGCATGCGGATACCTAGCGAAGAGCACATTTGGCGTAGCCTGTTAAGT
ATAACTGCTAAAAATTGAAATGAACACCAACTGAAACAACTGTTGGCCCTTTTTGAGGAT
CTAACCTGCGAAATGTTGATCTGACAGGCCTACTGAAAAACGGAAAGGAAAAAAGGCCTG
CGCAAACGCAGAACGCAGATCCGCCTTCTATTTGCGTATCGCACGCAGCCTCTGGCTACT
TGTTTAACTTACTATCTCTTTCATATATAAAAAAATAGCAATCGACTCTGGTAACTATTA
TGCTCCTCTTACTGGTTTTTTAGTGAATTGGCAATAGATAATATCAAGGACAACTTACTT
TTATTTTAACATCTACTTTACTTCATCGTCAAATTTTCTTCTTATATACAGCATTGCTAG
ACTCTATAGCTGCCAATTCATTCGCTTACCACATCATAATTTGCATACAAAAGAAAATCT
TTTCTTTTTTCCATTCATTCATTAAATTTAACGACAGACA
Chr coordinates Chr XVI from 66614-64977
w3c xhtml validator w3c css validator