Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name DIP5
Systematic Name YPL265W
Strain S288c
Description Dicarboxylic amino acid permease; mediates high-affinity and high-capacity transport of L-glutamate and L-aspartate; also a transporter for Gln, Asn, Ser, Ala, and Gly; relocalizes from plasma membrane to vacuole upon DNA replication stress
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>DIP5 YPL265W
ATGCTTTTCACCAGGTTGGTATCCATTTTTCATGAGCTCTCTTATCAATTATGTAAGTGC
TTGTATACTATTTACCTAAGATAAGAAAAAAAAAAGCAATTCAAAATTAAGCTTATCTTG
ACAGCGGGGCTGGTTTGTTTCTAGAAGACAAAAAGTGGGGAATCATTTTTACGTAACTCC
CCCTGATAAGAAGGACTCACATCCTTATAGGTACGATAAAGAATGGTTGTATCTTTCCTA
TTTTTCGAAATCGTTATCTTATATAGTTGAACTACTACGGTTAAAAAGCTTAAGCCTCAG
CCCTCTTAGTCAAACTTCTTTTTTGAAGGCACCAGGGTGCATAAAAGTGCGTCTATTGTT
TCCCAGTGGAACTCTGTTGAGATAGCGATGTTTGTTTTTTTTTCACTTAACGGCAACCAA
TACCGATAGCGACGTCGCTGGCAGTGTAGAGTGGCCGTACGGCGTCGCTAGATGGCACGG
CACTGATTGCGGCGGGAGTCGCTAGGCGGTGATGCATTTCCGCACAGGGACCAGAGGAAG
CTTCCCAGGCGGTGACAGTAAGTGAACTCATTATCATGTCTTCTCCAAAACATTCGTGAC
ATCTAGTCATGCTCCTCGCAATTCACTCCGATTGGTATAGCTTTTTCGGTAGTTTTAGCT
ACTATGCTTAGGGGAAAGAGGAGAAACCGTACCGTCAGTCTCAGTCAAAAAATTTTGATA
TTCAATCTGATAGCAAAGTTGGAACTTGGGGTTATCTGGCCCTTTTTTGTTATCATATTC
GTATACCCAACAACATATCGGTTCCACCGGTCCTTTTTATATATAAAAGACGATGTGTAG
ATGCACTCGAGTATTCTTGGAGAACGTAACTTGTATTGAGCTAGAGTGCTGGATAAAGTA
CCACATACTAACGTTCTTTTATAGAGCCAAACATAATTCTTTTGCACTTTCAATATAAGG
TACAAGTGAAACACAGGAAAAAAAGAACTAACTCTAAGTA
Chr coordinates Chr XVI from 41043-42869
w3c xhtml validator w3c css validator