Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PLC1
Systematic Name YPL268W
Strain S288c
Description Phospholipase C; hydrolyzes phosphatidylinositol 4,5-biphosphate (PIP2) to generate the signaling molecules inositol 1,4,5-triphosphate (IP3) and 1,2-diacylglycerol (DAG); involved in regulating many cellular processes; Plc1p and inositol polyphosphates are required for acetyl-CoA homeostasis which regulates global histone acetylation
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PLC1 YPL268W
AATAGCTACTAGCAAGAAGAAGATTCCAAAACCGAAATCATTAGGCTTTGGGCGACCGAA
TAGTGTTATTGGAACTATAACCCAGGATTTCCAGGAGAGAGTCGCCATTAATGAAGGTGA
CAGTAATAAAACACCGGAAAATTCAACTACAGTGGCTTTGAAAGGTAAAAAGCTTGGTAA
AGCGTTACTGCAGAAGATGAATATTAAACCTGCAACAAGCCCAAATTCATCAAATGCGAT
TAATCCATTTTTTGATCCGGAGTCGCCAAACAAAGGAAAACTGATACTAAGTAGTGTTCC
TCCCTTACCTTATGACGAAACCGATGAAACCACCCTCCGTGTTTCTCGTGGGGAAAATGA
AAAGTCACCAGACTCCTTCATTACATCTCGGCATGAAAATAAAGTACAGATTACAGAAAC
TCCTTTGATGGCAAAGAATAAGTCTGTGCTTGACATCGAAAAAGATAAATGGAATCATTA
CCGGTCCTTGCCCTCTAGGATCCCTATATACAAGGATAAAGTGGTGAAAGTCACCGTAGA
AAACACACCGATAGCAAAGGTTTTCCAGACTCCGCCAACAAAAATCACGACACCTAATAG
TCAAGTTTGGGTCCCTTCGACAAGAAGAAGAACCCGATTGAGGCCTCCCACCCCCTTATC
ACAGTTACTTTCACCAAGAGAAGGGCGTTTAGATAAAACCCCAACTTATTGATACTAACC
TAAAACTGTATACTTATACATTTTTATATATCCTCCCTCTCACCCTCTCCATTCATAGAA
TTTGTAATACTAGTTTAAATAATGTAATATTATGTGTAATTTTAAATAGTCCATGAAGAT
TCCGCACGTTTTCATTTTACAGTTTTTGACACCTTTACCCGACGCTTTATAAAAAAAATA
GTATAAGCATCACGACATAAGCAGCCTCAGGTCATTAAAACAATAAAAGACTGGGAATTA
TAAACGTACAACGGTAAGGTCATTCACGCAGTGTATATGA
Chr coordinates Chr XVI from 35236-37845
w3c xhtml validator w3c css validator