Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PBI1
Systematic Name YPL272C
Strain S288c
Description Putative protein of unknown function; gene expression induced in response to ketoconazole; YPL272C is not an essential gene
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PBI1 YPL272C
GATGGCAAACCTCCGCAATGATTGGCGTTCTAGCGGCTATCCGAATTCACAATCGACAAG
AAGTACTTCTAACTTACACAAGGCAACGAAATAATATCACTCTATGAAACTGCCATTTGG
GTAATAGGAGTATATTGAACGACACCGGGTCAACAAGCAACTTTCCTAAGCCTTTTACAC
TTCTTCACATCATTCAAGATCGCCTTTTAACGAGCTACAAACCTTCACGTTCGTTCTTCT
ATGGAAACGTTTAAGATAACGTTAAAACGTTCTCAATCACAGAATTTAAGATGATTAGAA
ATGTTTTCCAAGGGATAGGGCGAAGCACAACCTCGAAAAATGGCAAAATTTTAGAATCTT
AGCCACCTTAACGTCTACTTAGAGCCTTAGAAAAGCCATCAAGATTGGTGGAATAGTTGT
TGAGGGAACTTAGCCGCCACATTCTCGTAGCCAAATAAAGCGAATCTGACCATTGTATGT
TTCTTTTTCACTGGTATGATAGCCCAATGTGTTTAAGGAAAGTTAGGACAACACACCCGA
AGAAGGACGTCACCCCTGCATTCCCAAACGAGCTATGAAATAGCTCTTTCCTCTACAAGT
AATAACAACAACTTTTTTGTCTGTTTTCCGACCGTTTAACTTCAGAGATTAATTTTTTCA
ACGCGCTTTCGTTGAACGTCGCAAATTCGTTTAGAATAAACGAAAGGTGACAGAAATAGA
AGATTATAGCCATGCATACGCACATAAATTGAAAACTGTTTCGAGGCTGAGTATTCCCTG
CGTCTGCAGCCATCAGGGGTATGACTCTGCTACACGTTTACTATATTCTTGGCTAAACGA
TTCATTAACGAAGCGATGAGTAGATCACACTCGGCATACGAGCACAAATTTGTATGGGGG
GACGGTCATATATAAAAGGGTGTATACGTTATCCTTGTTATACCTGTCCAAAGAAGTGCA
TTTGTAACTCACAACACAGACACATCCTCACTTTATCATA
Chr coordinates Chr XVI from 28164-26611
w3c xhtml validator w3c css validator