Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SAM4
Systematic Name YPL273W
Strain S288c
Description S-adenosylmethionine-homocysteine methyltransferase; functions along with Mht1p in the conversion of S-adenosylmethionine (AdoMet) to methionine to control the methionine/AdoMet ratio; SAM4 has a paralog, YMR321C, that arose from a single-locus duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SAM4 YPL273W
CTAATTCAAGCTTTAGGTGCATCTGGCCAACTTCCTTCGGTATGTTCCTACATGGACAGA
AAGGGTAGGCCTTTGGTTGGCATTGGGATTAGTGGTGCATTTGGTCTTTTAGGTTTTCTT
GTGGCCTCGAAAAAGGAGGACGAGGTCTTCACTTGGCTTTTCGCCCTTTGTTCCATTTCA
TCATTCTTCACCTGGTTCTGTATTTGTATGTCACAAATTAGATTTAGGATGGCTTTGAAA
GCTCAAGGAAGATCCAATGACGAAATAGCTTACAAATCCATACTGGGTGTTTATGGTGGA
ATTTTGGGGTGTGTGCTAAATGCATTGCTAATTGCGGGTGAAATATACGTATCGGCCGCC
CCGGTCGGTAGCCCTAGCTCCGCTGAAGCCTTCTTTGAATACTGTTTAAGTATTCCAATC
ATGATTGTTGTTTATTTTGCACATAGGTTTTATCGAAGAGATTGGAAACACTTCTACATC
AAGAGGAGTGAGATCGATCTGGATACTGGGTGTTCCGTGGAGAATCTAGAGCTTTTCAAA
GCACAAAAAGAAGCTGAGGAACAACTCATTGCTTCTAAGCCATTCTATTACAAAATCTAC
AGATTTTGGTGTTAGATGGTACTCTTGCATATGTAACCTTTAATAAATTTTGCAAATCGA
ATTCCTTTGTAACGTGCAAAGCATTTTATAGCCTGGCGCTCGCATTGTTAAGCAACAGGC
GGTGCGGCAACGTTGAAATGTTTCACGCAGGGTTTTTTACGTACTGCACGGCATTCTGGA
GTGAAAAAAAATGAAAAGTACAGCTCGAAGTTTTTTGTCCATCGGTTGTACTTTGCAGAG
TATTAGTCATTTTTGATATCAGAGTACTACTATCGAAGCATTTTTACGCTTGAATAACTT
GAATATTATTGAAAGCTTAGTTCAACCAAGCTGAAAAGAACCATTATTCAACATAATTGG
AAATCATTTCGTTACTAAATCGTCCGAAAATTGCAGAAAA
Chr coordinates Chr XVI from 25087-26064
w3c xhtml validator w3c css validator