Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name PAU22
Systematic Name YPL282C
Strain S288c
Description Protein of unknown function, member of the seripauperin multigene family encoded mainly in subtelomeric regions; identical to Pau21p; encodes 2 proteins that are translated from 2 different start codons
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>PAU22 YPL282C
CAAGTTATTTTATTCATATGTTTTATCTTGTAGGAAATCAAACCGTTTTTAAAGTTTTCC
ATTGCCTACACACAAAATCATTACGAATCTGTCTGAACAAGGGTGGACGTGTGGGGGAAG
GCTGTTCCAATCAAGAAATGCTTACAACTCTACTAACACTGCAGTTTTTCAGCTTTCTGA
TTAATCTCTTCGGTTTAAATTTTTTAGCAGCTATTACTTTCTAGTAACCCTTATAACGCG
GTTGGTATCAAATCTTCCTGATAGTACAAGCAGACCTTTGACCCCATTCTTGTTGTGTCT
TGAAATCTTTTTTTCTGACAAAAGTAAGAAGTTACACCATAATAGAGAAGTTAAATAATG
AAAGTGTATCGATCATAGAAATGATTTTATTTTTTTCAACTACTGTTACGGTCAAGAAAC
TAATACTGAGGATAAGTTTTCGCAACAATGATTTTGGTACAAGTGATTTAAAGTCTTGAA
TTACTTCAACACAATTTGCTTTGCGACGGTTTAGAATAACGTAATCGTATCAACGAATCC
ACTAGGCGCGCGTAAAAATTACAGACTCTAACAATATACGACTCCCAGCACATACCTACT
ATTCTGTACAATTCCGGGAAATAGGAGGGTACAGTATTATTTTTTCTCGGCGATCGTTTA
GGGTATACTGGAGATAGGCTTAGCAATACGCTTCTGAACGAGGATCTATAGCAACTAAAT
TCAGACATTCTGCTATACCAAAAAAGGAAGTATCACAGGCACGGAAAAGGGTTTTATAAG
GCACCTCGGCACCCCTATAACTGGCATTCTCACATTCGGCGCATACGAATAGACAAAGGC
CCCAGAAAACAATACCTTCGCATACAGAATCTATAAAGATGCATGCCTCGTTTAAAAACA
AAAACATCTTCATAGTGATCATGAAGTTGTGGGAAAGATGAGATATGGAGAATATGTGAA
GTGCTAAAGGAGCATCTGTTAACGAATCGTTTAAGTGGTG
Chr coordinates Chr XVI from 8427-7933
w3c xhtml validator w3c css validator