Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SUT2
Systematic Name YPR009W
Strain S288c
Description Putative transcription factor; multicopy suppressor of mutations that cause low activity of the cAMP/protein kinase A pathway; highly similar to Sut1p
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SUT2 YPR009W
TAACTCCCGATTCTTTTAAATAATTACATAAACTAGGAAGGCAAGTCCGAACACGCAGAG
ATGAGGTATTTGCACTCAATGACAAATCTAGGTTTAAACTACGGGGCTCCATACCTTATC
TCTTCACTTATCAAAAGTAGGCAAAAGAAAAGAAAATAAATATAATTTCTTTTTCTGCAG
GCAAGATTTTAAAAGAACTTGCGCGTCCTCTGTGCAATCTACCTGGGGAGTCTCGGGCTT
TAACCGCTCCCCATTCTAAACTGCTTCCATTGACGTGTACTATACTGCTCACTTCTTGCT
CTTCGAGCAACAAAATCTGTATTACGTTTCTTACACTAGTCGAGTGAAAGAGATAAGATA
CCCACTTTTACTTGCCGGGAGAATGGAAAAGAGAAAACGGAAGAAAGGGCTTAAATACAT
TTTCCTTTAATATGAACATCCTACTGTAAGATAAAAATTGGATGCTGATAATGGAAAGGA
GACATGTACGGTATGTACGGCAAAACCTCGGCGGGTTTTCGCCGCTAGCTCATATATTCT
TTCGTTAAATTTTAAAATTTCTTATTCTAAATCTTCTTTACATGTTTGGAAAGAATTTAT
TGGAGAGAAAAATCTAGACCTGCCAAGCCGATAAACGAATGCCTGCGAAGAAATAGTGTA
AATATTACTCCTGAAGGTAGAGTCATCTAGGCGGAGACGAAAACAAAGTTTAGCTTTTCG
TGAAATTGCCCATTTCATGTTTATCAACCACCAAAGGTTAAATGGAGGTTTGACAAAAGA
AATTTTCTTGCTAAAGGTTAGCATTTTTTTTGGAATTTTTTTTCCTTCGACTGGCTGTAG
TTGTCCTTCTATATTACGTACAACAAAAACTTTCTTGAATGAAGAATTAGTTCTATCATA
TAGACCATAAGAAAGAAAACGCACTTGGATAATTTTTAACAAAGAAGAGGGCAAACTGAC
GCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGAT
Chr coordinates Chr XVI from 576552-577358
w3c xhtml validator w3c css validator