Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SUT2
Systematic Name YPR009W
Strain S288c
Description Zn2Cys6 family transcription factor; positively regulates sterol uptake under anaerobic conditions with SUT1; represses filamentation-inducing genes during non-starvation conditions; positively regulates mating along with SUT1 by repressing the expression of genes (PRR2, NCE102 and RHO5) which function as mating inhibitors; multicopy suppressor of mutations that cause low activity of the cAMP/PKA pathway; SUT2 has a paralog, SUT1, that arose from the whole genome duplication
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SUT2 YPR009W
TAACTCCCGATTCTTTTAAATAATTACATAAACTAGGAAGGCAAGTCCGAACACGCAGAG
ATGAGGTATTTGCACTCAATGACAAATCTAGGTTTAAACTACGGGGCTCCATACCTTATC
TCTTCACTTATCAAAAGTAGGCAAAAGAAAAGAAAATAAATATAATTTCTTTTTCTGCAG
GCAAGATTTTAAAAGAACTTGCGCGTCCTCTGTGCAATCTACCTGGGGAGTCTCGGGCTT
TAACCGCTCCCCATTCTAAACTGCTTCCATTGACGTGTACTATACTGCTCACTTCTTGCT
CTTCGAGCAACAAAATCTGTATTACGTTTCTTACACTAGTCGAGTGAAAGAGATAAGATA
CCCACTTTTACTTGCCGGGAGAATGGAAAAGAGAAAACGGAAGAAAGGGCTTAAATACAT
TTTCCTTTAATATGAACATCCTACTGTAAGATAAAAATTGGATGCTGATAATGGAAAGGA
GACATGTACGGTATGTACGGCAAAACCTCGGCGGGTTTTCGCCGCTAGCTCATATATTCT
TTCGTTAAATTTTAAAATTTCTTATTCTAAATCTTCTTTACATGTTTGGAAAGAATTTAT
TGGAGAGAAAAATCTAGACCTGCCAAGCCGATAAACGAATGCCTGCGAAGAAATAGTGTA
AATATTACTCCTGAAGGTAGAGTCATCTAGGCGGAGACGAAAACAAAGTTTAGCTTTTCG
TGAAATTGCCCATTTCATGTTTATCAACCACCAAAGGTTAAATGGAGGTTTGACAAAAGA
AATTTTCTTGCTAAAGGTTAGCATTTTTTTTGGAATTTTTTTTCCTTCGACTGGCTGTAG
TTGTCCTTCTATATTACGTACAACAAAAACTTTCTTGAATGAAGAATTAGTTCTATCATA
TAGACCATAAGAAAGAAAACGCACTTGGATAATTTTTAACAAAGAAGAGGGCAAACTGAC
GCTCACCAAGCTATTGGTTTGTTTGGATCAATCGTCAGAT
Chr coordinates Chr XVI from 576552-577358
w3c xhtml validator w3c css validator