Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SDD4
Systematic Name YPR022C
Strain S288c
Description Putative protein of unknown function; green fluorescent protein (GFP)-fusion protein localizes to both the cytoplasm and the nucleus and is induced in response to the DNA-damaging agent MMS
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SDD4 YPR022C
TATGCAGGGTTTACTTCATACAGAAAGACACTTGCTTGTTGTCAATGGCTAAAAAGGACC
TCAGGCAAAAGCGTAGGATAATTACAAGTTGTTCGAAAAGGAGTTGTTTATATTTATTCA
TCGCTCAATGCAGAAGCATAACAATTGTAATAACACTCATTATAGATAGAGCTTGCATTA
AATACACGTCTATCCTTTCAACCCAAGGCATTTGAAGGAAAGGAATGAAAAAGAGGAAAC
GTTTGATATTCGTCAGGCTATTACTTGACTATGAAACATGTACAGGTTGGTCTACTGCTG
TAAAAAAAAAAAAAAGTCCTTAACTCGCTTATTTAAGGGAACCATTATTTTCGGGGATTG
TAAATTTACTGACTATGCAATGAGTTTAACAGGCTGATCAATTATGCCCTAGCAAAAAAA
ACTGAAATGATGCACCTCGAACTCTAGTGCATTAGCTTGAAGCTTTATTCTCCTGCTAAA
AAAAAAAAAAAAGTACTAATTTGCTTGGAAGCGAGCACCCTATTGCTTTTAAAATTCTCC
ATATGGGCTTCCCCACCTACCTCTTAAAAGTTATGTCATCGGTCTTGAATTGTTTCCAAA
GACCTTCCGCTTTATCAATTCTTTCCTCGTATATCAGTGTCCTCTAACAAGACTACCGTG
CTTTTTCGTGGATTTCATGTAGGAGCCAATCGTTTTTAAGAAAAATTACTGTCAAGGTAG
TTTGAGAAGAAATTGCGAGATATCACATGTGCGCTTTCCTTCTCCACTGATCGAATTACA
GTAAGACTTTTAAAGATTCTAAGTAATTAGAATAGTTAACTGTTTTTTTTGTTTTTTTTT
TTTTTCGTTCTGCTTTATTTTTTTATTTTTTTTGTGAGTTGCGAACAGCTTCTTTAATAG
TTTTAAAGGCTGTATTGAGATTCTAGGACTCATCTACTATGTTTATAATTATAAAAAGTG
ACCAATAAAGCAGTGAAGCTAGCTCTTAATATTGGCAAAA
Chr coordinates Chr XVI from 607312-603911
w3c xhtml validator w3c css validator