Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name YOP1
Systematic Name YPR028W
Alias YIP2
Strain S288c
Description Membrane protein that interacts with Yip1p to mediate membrane traffic; interacts with Sey1p to maintain ER morphology; overexpression leads to cell death and accumulation of internal cell membranes
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>YOP1 YPR028W
TCGAAAAAATAAATGCGAATTCTGTGGATCGAACACAGGACCTCCAGATAACTTGACCGA
AGTTTTTTCTTCAGTCTGGCGCTCTCCCAACTGAGCTAAATCCGCATATCAGAATGAAAT
AAACAAGCATTCTTGTGCTTTATAAATGGTCCAAGCGTCTAACTTTTAAAGAGTACATTC
TAAAAGTAAGAGACGAAGACAACATTATAATAATTTTCTCAAGACATATATGTTTCACCG
GCACGTTTTGTTTTGTCCCCTTTTATTTTGAGCCTGAATACTATGCTTTATAAAACTTTA
ATGCGCTCAACAAGTGCACCTTCCAACGGAAAAAAAGAAATTCAACAGGGAGCGATGCCA
TCATCACATGCACGTTTTCAAGTATTTATAAGACTTGCTACTTGCTCGTCCATTCATGAC
TTTAATGAGGTTCTAATTTATTGGTGCAACTCTTCAAACTAGCTGCCCAATCAGTGCTGG
AATGAGTGCCAAGACAAGCGACAAACCCTGTCAATCTCCTGAAAAACAAAAATTAAGTGC
TTGAGAAGACCTTCAGAAGAGTTGCATAGATAGGATGGGTGAGCGCAATTACTAGTTACG
CAGTAAGTAGGTTATATGGCTGCTGGAGGGGCAGTACTGATTTAATCACAATCCGGATTA
AACTTCCTCCTGAAAAAAAAAAAACTACATCAAGTCAAAAGATTTTCATTCACTCTTTGG
AAGGCTGTGTGGCATTCTAACCTTTATTTTTTTATCACCATTCTCGAATTTTCGTGGTTC
GCTTTCTTAGCGCCGTTATTCTCTCTTCTTGTCCACGTCAAAGGGAGTATGCGTAACCCC
TTTCAAGGTTGAACGAAAAAAAAAAAAATATGTCCTTCAAAATTTTTTTTGATTTAAAAC
TAAAAAACATTCCCTTGAAGCTTGTTATTCCGAAAGAAAGAATCTAAAATTGCAATTGGT
AGTGAAAACAAATAAACAAAGACATAACCGCACTCCAATC
Chr coordinates Chr XVI from 623527-623577,623711-624202
w3c xhtml validator w3c css validator