Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIF5
Systematic Name YPR041W
Alias SUI5
Strain S288c
Description Translation initiation factor eIF5; functions both as a GTPase-activating protein to mediate hydrolysis of ribosome-bound GTP and as a GDP dissociation inhibitor to prevent recycling of eIF2
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>TIF5 YPR041W
TACATCAGGATCGAAAATTCAAAACAGCATTGGTCCATAGAGTTCAATGCCCTGGATGCT
TTAAAGGAGGTTCAACTCCAGGATTCAGGTATTCGTGTTGCGTACTCAAACGACTGGATA
AATTCTAAAAAAAGACAAAATTCAACTAATGGTGCGCAACGGTTCACTAACGATGTGAAC
GACGATTCCTTAAATATCATACACAAGTACGACTGGACCTACACTACGCGGTATAAGGGC
ACAGAGAGCTCACCTGAGTCGAAATTCCGACTGGATAACGATCAAAAGCTGCCCCTTGAC
AAACTGGCCGTACACGATAAAATCCTATTCTATGACGACATGATTCTTTTCGAAGACGAA
TTGGCAGACAATGGCATATCAATCCTTAACGTCAAAATAAGAGTTATGAACGAAAGGTTA
CTGCTGCTGAGCCGGTTCTTTTTAAGGGTGGACGATGTTCTGGTGAGGGTCTACGACACC
AGGATTTACGTGGAGTTTGACGAAAACGTAGTGATCAGAGAATCCAAGGAATTTGAAGGT
AAATATCAGGATGTACTTGCTAAGCACCGGCTATCCCAATCTCACGACCCAAAAGCTGCC
TTGAGAGATAGTAATTGGGTAGCACAGAACACGCCGATGATCAAAAGACAATGTGAAATA
ATTCAGTTCTAACAATCAAATATACAAAACAATACGTACAAATACATACACGTCACATAT
ACATAAGCTCCGGATACATCATACAAGAAATGATCTTAAAATCATGCTCTTACCCGTTCT
GTAAATAGTGAAAAATTTTCATCGCGAAGTATGAACGAAAAAAAAAAAAGAAAATAGATG
AACTTTTAGCATTTAATTAGTGGCAAACGCCTACCCCTCCTTCCCACTTTGCTGACTTAC
AAAGACACCACTACATTAAAGAGTATCTCGTGTGTTCTTCTTTTTTTTCCAAAAAAAAAA
ACTCCTATTATTTGCATAAACACACGTTCACTGGTACAAG
Chr coordinates Chr XVI from 648704-649921
w3c xhtml validator w3c css validator