Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name TIF5
Systematic Name YPR041W
Alias SUI5
Strain S288c
Description Translation initiation factor eIF5; functions as both a GTPase-activating protein (GAP) that stimulates the hydrolysis of GTP bound to eIF-2, as part of the 43S preinitiation complex, and as a GDP dissociation inhibitor (GDI) to prevent recycling of eIF2; human ortholog eIF5 complements the yeast null mutant
External sources Open in SGD external link
Open in KEGG external link
Gene Sequence
Download FASTA
Hide Seq
>TIF5 YPR041W
ATGTCTATTAATATTTGTAGAGATAATCATGATCCATTTTACCGTTACAAAATGCCTCCC
ATCCAAGCCAAGGTGGAAGGTAGAGGTAACGGTATCAAGACTGCCGTTTTGAACGTCGCT
GACATCTCTCACGCGCTAAATAGACCTGCTCCATATATTGTCAAGTATTTTGGTTTCGAA
TTAGGTGCTCAAACTTCCATCTCTGTTGACAAAGATCGTTATTTAGTTAATGGTGTTCAC
GAACCTGCCAAATTGCAAGACGTATTGGATGGCTTTATTAACAAGTTTGTTCTCTGTGGA
AGCTGTAAAAATCCAGAAACGGAGATCATCATTACCAAAGATAATGATTTGGTTCGAGAC
TGTAAAGCCTGTGGTAAGAGAACTCCAATGGACTTGAGACATAAACTATCATCCTTCATT
TTGAAAAACCCACCTGACTCCGTTTCTGGTTCCAAGAAGAAGAAGAAAGCAGCTACCGCT
TCGGCCAATGTTCGTGGTGGTGGGTTGTCCATTAGTGATATTGCTCAAGGTAAGTCTCAG
AATGCACCTTCAGATGGCACCGGCTCATCCACTCCACAACATCATGACGAAGACGAAGAT
GAATTATCTCGTCAAATCAAGGCGGCTGCCTCTACCTTAGAAGATATCGAGGTCAAAGAT
GACGAATGGGCGGTTGATATGTCTGAAGAAGCCATTAGAGCTCGTGCCAAGGAACTAGAA
GTGAACTCTGAGCTCACTCAACTGGATGAATATGGTGAATGGATTTTGGAGCAGGCTGGT
GAAGATAAGGAGAACTTACCATCAGATGTGGAGCTTTATAAGAAGGCTGCAGAACTAGAC
GTCTTGAATGATCCAAAAATTGGTTGTGTCTTGGCGCAATGTCTATTCGATGAGGATATC
GTAAACGAAATCGCTGAACATAATGCATTTTTCACTAAAATTTTAGTCACTCCAGAATAC
GAAAAGAACTTTATGGGTGGTATTGAAAGATTTTTAGGTTTAGAACATAAGGATCTAATC
CCACTATTACCAAAAATTTTGGTACAACTATACAATAATGATATCATCTCGGAAGAAGAA
ATCATGAGATTTGGTACCAAATCATCCAAGAAATTTGTACCTAAGGAGGTATCCAAAAAG
GTTCGTAGGGCTGCTAAGCCATTCATTACGTGGTTAGAAACCGCTGAAAGTGACGATGAT
GAAGAAGACGACGAATAG
Promoter Sequence
Download FASTA
>TIF5 YPR041W
TACATCAGGATCGAAAATTCAAAACAGCATTGGTCCATAGAGTTCAATGCCCTGGATGCT
TTAAAGGAGGTTCAACTCCAGGATTCAGGTATTCGTGTTGCGTACTCAAACGACTGGATA
AATTCTAAAAAAAGACAAAATTCAACTAATGGTGCGCAACGGTTCACTAACGATGTGAAC
GACGATTCCTTAAATATCATACACAAGTACGACTGGACCTACACTACGCGGTATAAGGGC
ACAGAGAGCTCACCTGAGTCGAAATTCCGACTGGATAACGATCAAAAGCTGCCCCTTGAC
AAACTGGCCGTACACGATAAAATCCTATTCTATGACGACATGATTCTTTTCGAAGACGAA
TTGGCAGACAATGGCATATCAATCCTTAACGTCAAAATAAGAGTTATGAACGAAAGGTTA
CTGCTGCTGAGCCGGTTCTTTTTAAGGGTGGACGATGTTCTGGTGAGGGTCTACGACACC
AGGATTTACGTGGAGTTTGACGAAAACGTAGTGATCAGAGAATCCAAGGAATTTGAAGGT
AAATATCAGGATGTACTTGCTAAGCACCGGCTATCCCAATCTCACGACCCAAAAGCTGCC
TTGAGAGATAGTAATTGGGTAGCACAGAACACGCCGATGATCAAAAGACAATGTGAAATA
ATTCAGTTCTAACAATCAAATATACAAAACAATACGTACAAATACATACACGTCACATAT
ACATAAGCTCCGGATACATCATACAAGAAATGATCTTAAAATCATGCTCTTACCCGTTCT
GTAAATAGTGAAAAATTTTCATCGCGAAGTATGAACGAAAAAAAAAAAAGAAAATAGATG
AACTTTTAGCATTTAATTAGTGGCAAACGCCTACCCCTCCTTCCCACTTTGCTGACTTAC
AAAGACACCACTACATTAAAGAGTATCTCGTGTGTTCTTCTTTTTTTTCCAAAAAAAAAA
ACTCCTATTATTTGCATAAACACACGTTCACTGGTACAAG
Chr coordinates Chr XVI from 648704-649921
w3c xhtml validator w3c css validator