Yeastract
YEASTRACT+ INESC-ID IST IBB
Home > Go Back > View Contact/Credits     Tutorial     Help

 

Locus Information

Standard Name SEC8
Systematic Name YPR055W
Strain S288c
Description Essential 121kDa subunit of the exocyst complex (Sec3p, Sec5p, Sec6p, Sec8p, Sec10p, Sec15p, Exo70p, and Exo84p), which has the essential function of mediating polarized targeting of secretory vesicles to active sites of exocytosis
External source Open in SGD external link
Gene Sequence
Download FASTA
View Seq
Sequence hidden
Promoter Sequence
Download FASTA
>SEC8 YPR055W
CATTCGTCCGTGCAGCTCTCGGAGTTTCATATCAAATACTTTCTTTACCAAATCCTGTGT
GGGCTAAAGTACATACACAGTGCAGATGTCATCCACCGAGATTTGAAGCCTGGGAACATA
TTGTGCACATTGAATGGCTGTTTGAAGATCTGCGATTTTGGTCTCGCTAGGGGTATTCAT
GCCGGATTTTTCAAGTGTCATTCCACTGTGCAGCCCCATATAACCAACTACGTTGCTACA
AGATGGTATAGGGCGCCTGAGCTGCTTCTTTCCAACCAACCGTATAGTAAGTCCGTAGAC
ATATGGGCTGTAGGGTGCATTCTTGCAGAATTCTATGCTCGAAAGCCTGTTTTCATGGGG
CGTGACTCCATGCACCAGATATTTGAAATCATCAAAGTCTTGGGTACTCCTGATAAAGAT
ATTCTGATCAAGTTTGGCACCATTAAAGCTTGGAATCTAGGCAAAAACAGTAATAACCCT
GTATATAAAAAAATCCCATGGTCCAACATTTTCCCCTTTGCCTCGCATGAAGCAATCAAT
CTCATAGAGTCATTACTTCATTGGGACTCAACACATAGGTTAAACGTGGAACAAGCTATA
TCACATCCGTTCCTAAACGAGGTGCGGAAGCCAGACGACGAGCCTGTTTGCCTTCAGGGT
CCTTTCGACTTCACCTATGAATCCGAGTTGAATTCAATGTCCAAATTAAGAGACTACTTG
GTTGAAGAAGTGAAAAATTTCAAAACCGATTTGTCCTCCTCGTCTTTATAGTAACCACTA
CACAAATAGGTATATCATGAAGTTATATTCTGACCGTAACAATTCTTCTTTCTTTGACGT
AAACTTTATGGCGGGTAACGCTCAAATAGTTTCTTGTTAACCATTTCAAATAACAATAAG
TATACAACTAAACAAAGTCTGCTACTTGTTAAATATAGGAGTATAAACAAGATAAGCTTG
CTACTTTTTCAGCACAACCGCCACCTCTCGATTGCATACA
Chr coordinates Chr XVI from 667676-670873
w3c xhtml validator w3c css validator